ID: 1029344285

View in Genome Browser
Species Human (GRCh38)
Location 7:99967202-99967224
Sequence CTGGCCTACGACTTCTACCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029344285_1029344292 14 Left 1029344285 7:99967202-99967224 CCTGGGTAGAAGTCGTAGGCCAG 0: 2
1: 0
2: 0
3: 4
4: 74
Right 1029344292 7:99967239-99967261 TCTTTTCTCCTGGGGCCTGGTGG 0: 2
1: 0
2: 2
3: 36
4: 368
1029344285_1029344291 11 Left 1029344285 7:99967202-99967224 CCTGGGTAGAAGTCGTAGGCCAG 0: 2
1: 0
2: 0
3: 4
4: 74
Right 1029344291 7:99967236-99967258 TCTTCTTTTCTCCTGGGGCCTGG 0: 2
1: 0
2: 1
3: 47
4: 395
1029344285_1029344289 5 Left 1029344285 7:99967202-99967224 CCTGGGTAGAAGTCGTAGGCCAG 0: 2
1: 0
2: 0
3: 4
4: 74
Right 1029344289 7:99967230-99967252 TCAGTTTCTTCTTTTCTCCTGGG 0: 2
1: 0
2: 9
3: 63
4: 778
1029344285_1029344290 6 Left 1029344285 7:99967202-99967224 CCTGGGTAGAAGTCGTAGGCCAG 0: 2
1: 0
2: 0
3: 4
4: 74
Right 1029344290 7:99967231-99967253 CAGTTTCTTCTTTTCTCCTGGGG 0: 2
1: 0
2: 6
3: 63
4: 655
1029344285_1029344288 4 Left 1029344285 7:99967202-99967224 CCTGGGTAGAAGTCGTAGGCCAG 0: 2
1: 0
2: 0
3: 4
4: 74
Right 1029344288 7:99967229-99967251 TTCAGTTTCTTCTTTTCTCCTGG 0: 2
1: 0
2: 10
3: 88
4: 797
1029344285_1029344293 18 Left 1029344285 7:99967202-99967224 CCTGGGTAGAAGTCGTAGGCCAG 0: 2
1: 0
2: 0
3: 4
4: 74
Right 1029344293 7:99967243-99967265 TTCTCCTGGGGCCTGGTGGCTGG 0: 2
1: 0
2: 2
3: 48
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029344285 Original CRISPR CTGGCCTACGACTTCTACCC AGG (reversed) Exonic
901558750 1:10052751-10052773 ATGAACTACGACATCTACCCAGG - Intronic
901657076 1:10775545-10775567 CTGGCCTAGGTCTTTTTCCCTGG + Intronic
902520090 1:17011244-17011266 GTGGCCCAGGACATCTACCCAGG + Intronic
905381199 1:37562655-37562677 CTGCCCTTTGACTTCTTCCCTGG - Intronic
906105401 1:43288897-43288919 CTGGCCTCCTGCTTCTACCCTGG - Intergenic
906376503 1:45300981-45301003 CAAGCCTACCACTTCAACCCAGG + Intronic
912115873 1:106407205-106407227 CTGGCCTATGACCTCTAGGCAGG + Intergenic
912439867 1:109689594-109689616 CTGGCCTCTGACTTCTGTCCTGG + Intronic
915326884 1:155085362-155085384 CTGGGCTACGAGTTCCACGCCGG + Exonic
916273583 1:162969669-162969691 CCAGCCTACTACTCCTACCCTGG - Intergenic
1070394919 10:76003591-76003613 CTGTCCTGCCACTTCCACCCGGG - Intronic
1071741022 10:88358305-88358327 CTGGCCTACAATTCCTGCCCAGG + Intronic
1089368545 11:117936236-117936258 CTGGCCTAAGACTTCAGACCTGG + Intergenic
1090066793 11:123510386-123510408 CTGGCCTGGTACTTCTTCCCAGG - Intergenic
1092649641 12:10619892-10619914 CAGGTCCACCACTTCTACCCAGG + Exonic
1096971554 12:55670487-55670509 CTGGCCTACCACTTCCATCTAGG + Intergenic
1100888417 12:99098364-99098386 CTTTCCTACAATTTCTACCCAGG + Intronic
1103118020 12:118354404-118354426 CTGACCTACTCCTTCTAGCCAGG - Intronic
1104406267 12:128519728-128519750 CTGGCCAAGGACTTCTAGCGAGG - Intronic
1104519605 12:129461229-129461251 CTGGACTAAGACTTTCACCCTGG - Intronic
1104844658 12:131840769-131840791 GTGGCCCACGCCTTCTTCCCCGG + Exonic
1128460341 15:67862126-67862148 CTGGCCTCCTACAACTACCCTGG - Intergenic
1129703056 15:77778990-77779012 CTGGCCTCCTCCTTCTCCCCTGG + Intronic
1130694259 15:86114373-86114395 GTGGCCTGCGTCTTCTACTCTGG + Intergenic
1131933212 15:97469738-97469760 CTGGCTTATGACTTCTGTCCTGG - Intergenic
1132310316 15:100852823-100852845 CTGGCCTCCCACCTTTACCCTGG - Intergenic
1132714048 16:1281947-1281969 CTGGCCAAAGATTTGTACCCAGG - Intergenic
1143868854 17:9943541-9943563 ACGGCCTACGACTTCCAACCAGG + Intronic
1144136821 17:12302968-12302990 CTGGTCTACTTCTTCTCCCCTGG - Intergenic
1144196675 17:12901453-12901475 CTGGCCTCTCACTTCTACCATGG - Intronic
1144855492 17:18265109-18265131 CTGGCCTTCAGCTTCTGCCCAGG - Exonic
1152176596 17:78792080-78792102 CTTGCCACCGACTTCTTCCCAGG - Intronic
1153596496 18:6730141-6730163 CTAGCCAACGACTTCAGCCCAGG - Intronic
1156950590 18:42892098-42892120 CTGACCTGGGCCTTCTACCCTGG - Intronic
1160983808 19:1828328-1828350 CTGGCCTTCGACTACAGCCCCGG - Exonic
1162329252 19:10017326-10017348 CTGGTCTACCCCTTCTGCCCAGG - Intronic
1162724471 19:12681651-12681673 CGGGGCTACGACTTCAACCGCGG - Exonic
1166000298 19:39873573-39873595 CTGGGCGAGGTCTTCTACCCGGG - Exonic
1167360078 19:49025448-49025470 CGGGCCTGAGACTTATACCCAGG - Intronic
1167361005 19:49030332-49030354 CGGGCCTGAGACTTATACCCAGG + Intronic
1167362645 19:49038465-49038487 CGGGCCTGAGACTTATACCCAGG - Intergenic
1167363488 19:49042723-49042745 CGGGCCTGAGACTTATACCCAGG + Intergenic
1167365007 19:49050203-49050225 CGGGCCTGAGACTTATACCCAGG - Intergenic
927945800 2:27134475-27134497 CGGGCCTTCGACTACTGCCCCGG + Exonic
934852156 2:97708165-97708187 CTGGCCTCCTACCTCTACCCTGG + Intergenic
941905210 2:170713193-170713215 CTGGCCTCCGACTTGCATCCAGG + Exonic
945150145 2:206782192-206782214 TTGGCCTAGGACTTCTCCCTTGG - Intronic
1174080288 20:47966553-47966575 CAGGCTCACGACTTCTTCCCAGG + Intergenic
1174137302 20:48388665-48388687 CAGGCTCACGACTTCTTCCCAGG - Intergenic
1175890218 20:62312662-62312684 CTGGCCGACGCCTACTACCTGGG - Exonic
1177094031 21:16808982-16809004 CTGGCAAAGGACTTGTACCCAGG + Intergenic
1181476541 22:23171260-23171282 CTGGCCTACACTTTCTACCTGGG + Intergenic
951912591 3:27767249-27767271 CTGGCCCACGGCCTCTATCCAGG - Intergenic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
961957747 3:130821631-130821653 CTGGTCTAGGTCTTCTACACAGG - Intergenic
963360172 3:144262118-144262140 CTGGCCTACCTCCTCTACACAGG + Intergenic
967293429 3:187943706-187943728 CTTTCCTACGGCTTCTACACTGG + Intergenic
968317512 3:197736878-197736900 CTGGGCTGCGGCTTCTATCCCGG + Intronic
969182353 4:5451934-5451956 ATCACCTAGGACTTCTACCCTGG + Intronic
985562125 5:593476-593498 CTGGGCTGTGACTTCTGCCCTGG - Intergenic
985661036 5:1156485-1156507 CTGGCCTCCGCCTTCCACCCTGG - Intergenic
986229843 5:5853076-5853098 CTGGCCCAACACTTCTTCCCAGG + Intergenic
986365173 5:7022089-7022111 CTGGCCAAAGAATTCAACCCGGG - Intergenic
989956383 5:50365883-50365905 CTGGCCCATGACTTCTACAAAGG + Intergenic
996056732 5:118990453-118990475 CTCACCTACTACTTCTGCCCTGG + Intergenic
997205117 5:132043670-132043692 CTGGGGTACTACTTCTGCCCCGG + Intergenic
997616423 5:135249208-135249230 CTGGCCTGTGACTTCCAGCCTGG - Intronic
997616653 5:135251095-135251117 CTGGCCTGTGACTTCTAGCCTGG - Intronic
1029344285 7:99967202-99967224 CTGGCCTACGACTTCTACCCAGG - Exonic
1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG + Intergenic
1036912305 8:12767480-12767502 CAGGCCTACAGCCTCTACCCTGG - Intergenic
1038395971 8:27245691-27245713 GTGGCCTTGGACTTCTACCTGGG + Intronic
1039518648 8:38153181-38153203 CTGGCCCCCGATTTCCACCCCGG + Intergenic
1040404773 8:47088874-47088896 CTGGGGTACTACTTCCACCCGGG + Intergenic
1061116727 9:128618132-128618154 CTGGCCTTCCACTTGTTCCCGGG - Intronic
1061917493 9:133762961-133762983 CTGGCCTTCGACTTCTGGCTGGG - Exonic
1186294900 X:8138429-8138451 CTGACCTACGCCTACTACCGTGG + Intergenic
1190064818 X:47232738-47232760 GTGGGCTAGGACTCCTACCCTGG - Intronic
1191669412 X:63735286-63735308 CTGGACTACGACTTGAAGCCAGG + Intronic
1199896496 X:152131987-152132009 TAGGCCTACGACTGCTACCTTGG + Intergenic