ID: 1029347193

View in Genome Browser
Species Human (GRCh38)
Location 7:99987252-99987274
Sequence CACCACAGAGGGAGGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347193_1029347206 26 Left 1029347193 7:99987252-99987274 CCACAGATCCTCCCTCTGTGGTG No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347193_1029347198 -7 Left 1029347193 7:99987252-99987274 CCACAGATCCTCCCTCTGTGGTG No data
Right 1029347198 7:99987268-99987290 TGTGGTGGTCACCAGCCACCAGG No data
1029347193_1029347199 0 Left 1029347193 7:99987252-99987274 CCACAGATCCTCCCTCTGTGGTG No data
Right 1029347199 7:99987275-99987297 GTCACCAGCCACCAGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347193 Original CRISPR CACCACAGAGGGAGGATCTG TGG (reversed) Intergenic