ID: 1029347193 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:99987252-99987274 |
| Sequence | CACCACAGAGGGAGGATCTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1029347193_1029347206 | 26 | Left | 1029347193 | 7:99987252-99987274 | CCACAGATCCTCCCTCTGTGGTG | No data | ||
| Right | 1029347206 | 7:99987301-99987323 | AAAGAAGAAACTGAAGTGCCTGG | No data | ||||
| 1029347193_1029347198 | -7 | Left | 1029347193 | 7:99987252-99987274 | CCACAGATCCTCCCTCTGTGGTG | No data | ||
| Right | 1029347198 | 7:99987268-99987290 | TGTGGTGGTCACCAGCCACCAGG | No data | ||||
| 1029347193_1029347199 | 0 | Left | 1029347193 | 7:99987252-99987274 | CCACAGATCCTCCCTCTGTGGTG | No data | ||
| Right | 1029347199 | 7:99987275-99987297 | GTCACCAGCCACCAGGCCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1029347193 | Original CRISPR | CACCACAGAGGGAGGATCTG TGG (reversed) | Intergenic | ||