ID: 1029347196

View in Genome Browser
Species Human (GRCh38)
Location 7:99987263-99987285
Sequence TGGCTGGTGACCACCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347196_1029347206 15 Left 1029347196 7:99987263-99987285 CCCTCTGTGGTGGTCACCAGCCA No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347196 Original CRISPR TGGCTGGTGACCACCACAGA GGG (reversed) Intergenic