ID: 1029347197

View in Genome Browser
Species Human (GRCh38)
Location 7:99987264-99987286
Sequence GTGGCTGGTGACCACCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347197_1029347206 14 Left 1029347197 7:99987264-99987286 CCTCTGTGGTGGTCACCAGCCAC No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347197 Original CRISPR GTGGCTGGTGACCACCACAG AGG (reversed) Intergenic