ID: 1029347200

View in Genome Browser
Species Human (GRCh38)
Location 7:99987279-99987301
Sequence TTCTCCTGGGGCCTGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347200_1029347209 19 Left 1029347200 7:99987279-99987301 CCAGCCACCAGGCCCCAGGAGAA No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data
1029347200_1029347206 -1 Left 1029347200 7:99987279-99987301 CCAGCCACCAGGCCCCAGGAGAA No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347200_1029347208 18 Left 1029347200 7:99987279-99987301 CCAGCCACCAGGCCCCAGGAGAA No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347200 Original CRISPR TTCTCCTGGGGCCTGGTGGC TGG (reversed) Intergenic