ID: 1029347202

View in Genome Browser
Species Human (GRCh38)
Location 7:99987286-99987308
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347202_1029347209 12 Left 1029347202 7:99987286-99987308 CCAGGCCCCAGGAGAAAAGAAGA No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data
1029347202_1029347213 30 Left 1029347202 7:99987286-99987308 CCAGGCCCCAGGAGAAAAGAAGA No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347202_1029347206 -8 Left 1029347202 7:99987286-99987308 CCAGGCCCCAGGAGAAAAGAAGA No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347202_1029347208 11 Left 1029347202 7:99987286-99987308 CCAGGCCCCAGGAGAAAAGAAGA No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347202 Original CRISPR TCTTCTTTTCTCCTGGGGCC TGG (reversed) Intergenic