ID: 1029347203

View in Genome Browser
Species Human (GRCh38)
Location 7:99987291-99987313
Sequence CAGTTTCTTCTTTTCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347203_1029347213 25 Left 1029347203 7:99987291-99987313 CCCCAGGAGAAAAGAAGAAACTG No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347203_1029347208 6 Left 1029347203 7:99987291-99987313 CCCCAGGAGAAAAGAAGAAACTG No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data
1029347203_1029347209 7 Left 1029347203 7:99987291-99987313 CCCCAGGAGAAAAGAAGAAACTG No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347203 Original CRISPR CAGTTTCTTCTTTTCTCCTG GGG (reversed) Intergenic