ID: 1029347204

View in Genome Browser
Species Human (GRCh38)
Location 7:99987292-99987314
Sequence TCAGTTTCTTCTTTTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347204_1029347214 30 Left 1029347204 7:99987292-99987314 CCCAGGAGAAAAGAAGAAACTGA No data
Right 1029347214 7:99987345-99987367 AAATTGATGTGCACTGGACTCGG No data
1029347204_1029347208 5 Left 1029347204 7:99987292-99987314 CCCAGGAGAAAAGAAGAAACTGA No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data
1029347204_1029347213 24 Left 1029347204 7:99987292-99987314 CCCAGGAGAAAAGAAGAAACTGA No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347204_1029347209 6 Left 1029347204 7:99987292-99987314 CCCAGGAGAAAAGAAGAAACTGA No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347204 Original CRISPR TCAGTTTCTTCTTTTCTCCT GGG (reversed) Intergenic
No off target data available for this crispr