ID: 1029347205

View in Genome Browser
Species Human (GRCh38)
Location 7:99987293-99987315
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347205_1029347213 23 Left 1029347205 7:99987293-99987315 CCAGGAGAAAAGAAGAAACTGAA No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347205_1029347214 29 Left 1029347205 7:99987293-99987315 CCAGGAGAAAAGAAGAAACTGAA No data
Right 1029347214 7:99987345-99987367 AAATTGATGTGCACTGGACTCGG No data
1029347205_1029347215 30 Left 1029347205 7:99987293-99987315 CCAGGAGAAAAGAAGAAACTGAA No data
Right 1029347215 7:99987346-99987368 AATTGATGTGCACTGGACTCGGG No data
1029347205_1029347208 4 Left 1029347205 7:99987293-99987315 CCAGGAGAAAAGAAGAAACTGAA No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data
1029347205_1029347209 5 Left 1029347205 7:99987293-99987315 CCAGGAGAAAAGAAGAAACTGAA No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347205 Original CRISPR TTCAGTTTCTTCTTTTCTCC TGG (reversed) Intergenic
No off target data available for this crispr