ID: 1029347206

View in Genome Browser
Species Human (GRCh38)
Location 7:99987301-99987323
Sequence AAAGAAGAAACTGAAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347200_1029347206 -1 Left 1029347200 7:99987279-99987301 CCAGCCACCAGGCCCCAGGAGAA No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347197_1029347206 14 Left 1029347197 7:99987264-99987286 CCTCTGTGGTGGTCACCAGCCAC No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347195_1029347206 18 Left 1029347195 7:99987260-99987282 CCTCCCTCTGTGGTGGTCACCAG No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347191_1029347206 29 Left 1029347191 7:99987249-99987271 CCTCCACAGATCCTCCCTCTGTG No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347193_1029347206 26 Left 1029347193 7:99987252-99987274 CCACAGATCCTCCCTCTGTGGTG No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347190_1029347206 30 Left 1029347190 7:99987248-99987270 CCCTCCACAGATCCTCCCTCTGT No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347201_1029347206 -5 Left 1029347201 7:99987283-99987305 CCACCAGGCCCCAGGAGAAAAGA No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347202_1029347206 -8 Left 1029347202 7:99987286-99987308 CCAGGCCCCAGGAGAAAAGAAGA No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data
1029347196_1029347206 15 Left 1029347196 7:99987263-99987285 CCCTCTGTGGTGGTCACCAGCCA No data
Right 1029347206 7:99987301-99987323 AAAGAAGAAACTGAAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347206 Original CRISPR AAAGAAGAAACTGAAGTGCC TGG Intergenic