ID: 1029347207

View in Genome Browser
Species Human (GRCh38)
Location 7:99987319-99987341
Sequence CTGGGTAGAAGTCGTAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347207_1029347213 -3 Left 1029347207 7:99987319-99987341 CCTGGCCTACGACTTCTACCCAG No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347207_1029347218 19 Left 1029347207 7:99987319-99987341 CCTGGCCTACGACTTCTACCCAG No data
Right 1029347218 7:99987361-99987383 GACTCGGGCCGGCGAGGTGCAGG No data
1029347207_1029347214 3 Left 1029347207 7:99987319-99987341 CCTGGCCTACGACTTCTACCCAG No data
Right 1029347214 7:99987345-99987367 AAATTGATGTGCACTGGACTCGG No data
1029347207_1029347215 4 Left 1029347207 7:99987319-99987341 CCTGGCCTACGACTTCTACCCAG No data
Right 1029347215 7:99987346-99987368 AATTGATGTGCACTGGACTCGGG No data
1029347207_1029347217 13 Left 1029347207 7:99987319-99987341 CCTGGCCTACGACTTCTACCCAG No data
Right 1029347217 7:99987355-99987377 GCACTGGACTCGGGCCGGCGAGG No data
1029347207_1029347216 8 Left 1029347207 7:99987319-99987341 CCTGGCCTACGACTTCTACCCAG No data
Right 1029347216 7:99987350-99987372 GATGTGCACTGGACTCGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347207 Original CRISPR CTGGGTAGAAGTCGTAGGCC AGG (reversed) Intergenic