ID: 1029347208

View in Genome Browser
Species Human (GRCh38)
Location 7:99987320-99987342
Sequence CTGGCCTACGACTTCTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347202_1029347208 11 Left 1029347202 7:99987286-99987308 CCAGGCCCCAGGAGAAAAGAAGA No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data
1029347200_1029347208 18 Left 1029347200 7:99987279-99987301 CCAGCCACCAGGCCCCAGGAGAA No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data
1029347205_1029347208 4 Left 1029347205 7:99987293-99987315 CCAGGAGAAAAGAAGAAACTGAA No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data
1029347201_1029347208 14 Left 1029347201 7:99987283-99987305 CCACCAGGCCCCAGGAGAAAAGA No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data
1029347203_1029347208 6 Left 1029347203 7:99987291-99987313 CCCCAGGAGAAAAGAAGAAACTG No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data
1029347204_1029347208 5 Left 1029347204 7:99987292-99987314 CCCAGGAGAAAAGAAGAAACTGA No data
Right 1029347208 7:99987320-99987342 CTGGCCTACGACTTCTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347208 Original CRISPR CTGGCCTACGACTTCTACCC AGG Intergenic
No off target data available for this crispr