ID: 1029347209

View in Genome Browser
Species Human (GRCh38)
Location 7:99987321-99987343
Sequence TGGCCTACGACTTCTACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347202_1029347209 12 Left 1029347202 7:99987286-99987308 CCAGGCCCCAGGAGAAAAGAAGA No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data
1029347200_1029347209 19 Left 1029347200 7:99987279-99987301 CCAGCCACCAGGCCCCAGGAGAA No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data
1029347204_1029347209 6 Left 1029347204 7:99987292-99987314 CCCAGGAGAAAAGAAGAAACTGA No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data
1029347201_1029347209 15 Left 1029347201 7:99987283-99987305 CCACCAGGCCCCAGGAGAAAAGA No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data
1029347205_1029347209 5 Left 1029347205 7:99987293-99987315 CCAGGAGAAAAGAAGAAACTGAA No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data
1029347203_1029347209 7 Left 1029347203 7:99987291-99987313 CCCCAGGAGAAAAGAAGAAACTG No data
Right 1029347209 7:99987321-99987343 TGGCCTACGACTTCTACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347209 Original CRISPR TGGCCTACGACTTCTACCCA GGG Intergenic