ID: 1029347210

View in Genome Browser
Species Human (GRCh38)
Location 7:99987324-99987346
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347210_1029347213 -8 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347210_1029347216 3 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347216 7:99987350-99987372 GATGTGCACTGGACTCGGGCCGG No data
1029347210_1029347214 -2 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347214 7:99987345-99987367 AAATTGATGTGCACTGGACTCGG No data
1029347210_1029347221 29 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347221 7:99987376-99987398 GGTGCAGGAGCCTGAGTTACGGG No data
1029347210_1029347222 30 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347222 7:99987377-99987399 GTGCAGGAGCCTGAGTTACGGGG No data
1029347210_1029347218 14 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347218 7:99987361-99987383 GACTCGGGCCGGCGAGGTGCAGG No data
1029347210_1029347217 8 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347217 7:99987355-99987377 GCACTGGACTCGGGCCGGCGAGG No data
1029347210_1029347220 28 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347220 7:99987375-99987397 AGGTGCAGGAGCCTGAGTTACGG No data
1029347210_1029347215 -1 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347215 7:99987346-99987368 AATTGATGTGCACTGGACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347210 Original CRISPR TTTCCCTGGGTAGAAGTCGT AGG (reversed) Intergenic