ID: 1029347213

View in Genome Browser
Species Human (GRCh38)
Location 7:99987339-99987361
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347207_1029347213 -3 Left 1029347207 7:99987319-99987341 CCTGGCCTACGACTTCTACCCAG No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347204_1029347213 24 Left 1029347204 7:99987292-99987314 CCCAGGAGAAAAGAAGAAACTGA No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347202_1029347213 30 Left 1029347202 7:99987286-99987308 CCAGGCCCCAGGAGAAAAGAAGA No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347203_1029347213 25 Left 1029347203 7:99987291-99987313 CCCCAGGAGAAAAGAAGAAACTG No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347210_1029347213 -8 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data
1029347205_1029347213 23 Left 1029347205 7:99987293-99987315 CCAGGAGAAAAGAAGAAACTGAA No data
Right 1029347213 7:99987339-99987361 CAGGGAAAATTGATGTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347213 Original CRISPR CAGGGAAAATTGATGTGCAC TGG Intergenic