ID: 1029347214

View in Genome Browser
Species Human (GRCh38)
Location 7:99987345-99987367
Sequence AAATTGATGTGCACTGGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347210_1029347214 -2 Left 1029347210 7:99987324-99987346 CCTACGACTTCTACCCAGGGAAA No data
Right 1029347214 7:99987345-99987367 AAATTGATGTGCACTGGACTCGG No data
1029347204_1029347214 30 Left 1029347204 7:99987292-99987314 CCCAGGAGAAAAGAAGAAACTGA No data
Right 1029347214 7:99987345-99987367 AAATTGATGTGCACTGGACTCGG No data
1029347207_1029347214 3 Left 1029347207 7:99987319-99987341 CCTGGCCTACGACTTCTACCCAG No data
Right 1029347214 7:99987345-99987367 AAATTGATGTGCACTGGACTCGG No data
1029347205_1029347214 29 Left 1029347205 7:99987293-99987315 CCAGGAGAAAAGAAGAAACTGAA No data
Right 1029347214 7:99987345-99987367 AAATTGATGTGCACTGGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347214 Original CRISPR AAATTGATGTGCACTGGACT CGG Intergenic