ID: 1029347334

View in Genome Browser
Species Human (GRCh38)
Location 7:99987966-99987988
Sequence CCCGGACCCGCTGTCCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029347326_1029347334 4 Left 1029347326 7:99987939-99987961 CCCTGACTTGGGCAATCCCAAGC No data
Right 1029347334 7:99987966-99987988 CCCGGACCCGCTGTCCCTTAGGG No data
1029347320_1029347334 29 Left 1029347320 7:99987914-99987936 CCTTGGAGGCCATGGTTCCTGGG No data
Right 1029347334 7:99987966-99987988 CCCGGACCCGCTGTCCCTTAGGG No data
1029347318_1029347334 30 Left 1029347318 7:99987913-99987935 CCCTTGGAGGCCATGGTTCCTGG No data
Right 1029347334 7:99987966-99987988 CCCGGACCCGCTGTCCCTTAGGG No data
1029347322_1029347334 20 Left 1029347322 7:99987923-99987945 CCATGGTTCCTGGGCACCCTGAC No data
Right 1029347334 7:99987966-99987988 CCCGGACCCGCTGTCCCTTAGGG No data
1029347327_1029347334 3 Left 1029347327 7:99987940-99987962 CCTGACTTGGGCAATCCCAAGCA No data
Right 1029347334 7:99987966-99987988 CCCGGACCCGCTGTCCCTTAGGG No data
1029347325_1029347334 12 Left 1029347325 7:99987931-99987953 CCTGGGCACCCTGACTTGGGCAA No data
Right 1029347334 7:99987966-99987988 CCCGGACCCGCTGTCCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029347334 Original CRISPR CCCGGACCCGCTGTCCCTTA GGG Intergenic
No off target data available for this crispr