ID: 1029349159

View in Genome Browser
Species Human (GRCh38)
Location 7:100000764-100000786
Sequence GGAGGGTCTCACCATTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029349159_1029349169 16 Left 1029349159 7:100000764-100000786 CCTCCCGAATGGTGAGACCCTCC No data
Right 1029349169 7:100000803-100000825 TGGCTACTTTTATCTAGAACAGG No data
1029349159_1029349170 22 Left 1029349159 7:100000764-100000786 CCTCCCGAATGGTGAGACCCTCC No data
Right 1029349170 7:100000809-100000831 CTTTTATCTAGAACAGGAGATGG No data
1029349159_1029349164 -4 Left 1029349159 7:100000764-100000786 CCTCCCGAATGGTGAGACCCTCC No data
Right 1029349164 7:100000783-100000805 CTCCCTCATCCCTGCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029349159 Original CRISPR GGAGGGTCTCACCATTCGGG AGG (reversed) Intergenic
No off target data available for this crispr