ID: 1029351309

View in Genome Browser
Species Human (GRCh38)
Location 7:100015096-100015118
Sequence GAGTGGTATTTTCAAATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029351309_1029351310 -9 Left 1029351309 7:100015096-100015118 CCAAGTATTTGAAAATACCACTC No data
Right 1029351310 7:100015110-100015132 ATACCACTCCATATAGCTCCAGG No data
1029351309_1029351311 -8 Left 1029351309 7:100015096-100015118 CCAAGTATTTGAAAATACCACTC No data
Right 1029351311 7:100015111-100015133 TACCACTCCATATAGCTCCAGGG No data
1029351309_1029351318 22 Left 1029351309 7:100015096-100015118 CCAAGTATTTGAAAATACCACTC No data
Right 1029351318 7:100015141-100015163 AGAAGCTACCGTGGCAGCTTTGG No data
1029351309_1029351319 23 Left 1029351309 7:100015096-100015118 CCAAGTATTTGAAAATACCACTC No data
Right 1029351319 7:100015142-100015164 GAAGCTACCGTGGCAGCTTTGGG No data
1029351309_1029351315 13 Left 1029351309 7:100015096-100015118 CCAAGTATTTGAAAATACCACTC No data
Right 1029351315 7:100015132-100015154 GGCCCTGAGAGAAGCTACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029351309 Original CRISPR GAGTGGTATTTTCAAATACT TGG (reversed) Intergenic
No off target data available for this crispr