ID: 1029353466

View in Genome Browser
Species Human (GRCh38)
Location 7:100032415-100032437
Sequence AAATGACAACAGAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 458}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029353466 Original CRISPR AAATGACAACAGAGGGAGCA TGG (reversed) Intronic
902697813 1:18152059-18152081 ATATAGCAACAGAGGGAGAAAGG - Intronic
903221201 1:21870588-21870610 GAATGGCAACTGAGGTAGCAAGG - Intronic
904175969 1:28629151-28629173 AACTGATAACAGAGGGAGGTGGG + Intronic
904283463 1:29437698-29437720 AGATGGCAAGAGAGGAAGCAAGG - Intergenic
904907673 1:33910255-33910277 AAATGAACACAGGAGGAGCATGG - Intronic
905179800 1:36158414-36158436 AAAGGAACTCAGAGGGAGCAGGG - Intronic
906168006 1:43702112-43702134 AAATGACAACACAGTGACAAAGG + Intronic
906305268 1:44714282-44714304 AAAAAAAAAAAGAGGGAGCAGGG + Intronic
906631690 1:47374956-47374978 TGATGACAACAGAGAGAGCTTGG + Exonic
906801917 1:48745436-48745458 AACGGACATCAGAGGGAGCAGGG + Intronic
907205389 1:52766065-52766087 AAATGAAAACAGACTCAGCAAGG - Intronic
908692314 1:66796282-66796304 AAATGACAAAAGACCGAGTAAGG - Intergenic
909130147 1:71724868-71724890 AGCTGACTCCAGAGGGAGCAAGG - Intronic
909819339 1:80041150-80041172 AAATGAGAAGAGAGGAAGGATGG - Intergenic
909863513 1:80637319-80637341 AAATGACAACAGAGGTTAAAAGG + Intergenic
909950271 1:81711730-81711752 AAATGTCAACAGAGTGAAAAAGG + Intronic
911607203 1:99920275-99920297 TAATGCCTTCAGAGGGAGCATGG - Intronic
911650196 1:100379829-100379851 ATATGGCAAGAGAGGGAGCAAGG + Intronic
911756218 1:101560024-101560046 ACATGGTAAGAGAGGGAGCAAGG - Intergenic
911902213 1:103521150-103521172 AAATGAGAAAAGATTGAGCATGG + Intergenic
912753619 1:112306104-112306126 AGATAAGAACAGAGGGTGCAGGG + Intergenic
913260114 1:116990060-116990082 CGATGACAACAGAGGAAGAAGGG + Exonic
915001252 1:152595028-152595050 AAATGGAAACAAAGAGAGCATGG - Intronic
915212549 1:154321309-154321331 TAAGGACAACAGAAGGAGCCAGG - Intronic
916363381 1:163996516-163996538 TAATGACAGCAGATGTAGCATGG - Intergenic
916389409 1:164314738-164314760 AAGCGAAAACAGAGGTAGCAGGG + Intergenic
917621114 1:176796904-176796926 AAAAGAAAATAGAGGGAGGAAGG - Intronic
917635261 1:176929716-176929738 AAATGATAACAGACCGGGCACGG + Intronic
917686595 1:177422889-177422911 AAATGAAAAAAGAGGGAGAGAGG + Intergenic
918096890 1:181343448-181343470 ATACGGCAAGAGAGGGAGCAAGG - Intergenic
918226415 1:182487357-182487379 AAGTGGCAAGAGAGGAAGCAGGG - Intronic
918337847 1:183538693-183538715 AGAGGATAACAGATGGAGCAAGG - Intronic
918547564 1:185701806-185701828 AAATGAGAAGAGAGAGAGCTGGG - Intergenic
918616652 1:186551558-186551580 AAAAAACAACAGAGGAAGAAAGG - Intergenic
920086909 1:203424046-203424068 AACTGAGCACAGAGGGAGGAAGG + Intergenic
920770348 1:208878879-208878901 GAATGACTACAGAGGGAGCATGG - Intergenic
921022953 1:211253198-211253220 AAATTACAGCAGTGGTAGCAAGG - Intergenic
921938148 1:220813469-220813491 AAATGACAACACTTGAAGCATGG + Exonic
922567893 1:226612796-226612818 AAATGACAACAGAGGTTAAAAGG - Intergenic
922607627 1:226900362-226900384 AATTGTCCACAGAGGGGGCAGGG - Intronic
924010986 1:239665089-239665111 AAAGGACAAGAGAGAGAGGATGG - Intronic
924258247 1:242203618-242203640 CAGTGGCAAGAGAGGGAGCAAGG - Intronic
1063983959 10:11481067-11481089 GAATGATAACAGAGGGTGAATGG - Intronic
1064909615 10:20385542-20385564 AAATGAAGTCAGAGGAAGCAAGG + Intergenic
1064960951 10:20964478-20964500 ACATGGCAAGACAGGGAGCAAGG + Intronic
1064967488 10:21029865-21029887 CAATGACTACAGAGGAGGCAGGG + Intronic
1065037267 10:21652555-21652577 ATATGAAAACAGAGGGAGACTGG + Intronic
1065552381 10:26881861-26881883 CAGTGACAACATAGGCAGCATGG + Intergenic
1065813761 10:29465640-29465662 AACTGACCACAGAGGGGGCTCGG + Exonic
1065957898 10:30709386-30709408 AACTGACCACAGAGGGGGCTCGG - Intergenic
1066167752 10:32806686-32806708 AAAAGAAAACAGAGAGAGAAAGG + Intronic
1066477829 10:35765057-35765079 CAAGGACGGCAGAGGGAGCAGGG - Intergenic
1067130047 10:43555774-43555796 AAATGAATACATAAGGAGCAGGG - Intergenic
1067844351 10:49708064-49708086 ATATGACAATAGAGTGTGCAGGG - Intronic
1068263692 10:54619490-54619512 AAAAGAAAACTGAGGGAGAAAGG - Intronic
1068299471 10:55120108-55120130 AATTGACAACAGAGGAAACAGGG + Intronic
1068756488 10:60660500-60660522 AAATGACAACAGGGGCAACTTGG - Intronic
1070679238 10:78437112-78437134 CGAAGACCACAGAGGGAGCAGGG - Intergenic
1070973074 10:80583371-80583393 AAAAGACAACAGATGGAGCCGGG + Intronic
1071112357 10:82174734-82174756 AAATCATAACAGAGTGAGCCAGG - Intronic
1071253512 10:83844776-83844798 AAATGAGAACAGATGGACAAGGG - Intergenic
1071775094 10:88777837-88777859 AATTTGCAAAAGAGGGAGCAAGG - Intronic
1072200879 10:93157795-93157817 ACATGGCAAGAGAAGGAGCAAGG - Intergenic
1072201003 10:93158767-93158789 ACATGGCAAGAGAGTGAGCAAGG - Intergenic
1072718216 10:97765522-97765544 AAATGACTCCAGAGGGGCCAGGG - Intergenic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1073803615 10:107071128-107071150 AGTTGCCAAAAGAGGGAGCATGG + Intronic
1076378072 10:130004947-130004969 AAAGCACAAAAGAAGGAGCAGGG - Intergenic
1076640340 10:131911650-131911672 AAATGACAACAGCGTGAAAACGG + Intronic
1076925931 10:133487016-133487038 AAATAATAACAGATGAAGCAAGG - Intergenic
1077280163 11:1740957-1740979 ACATGGCAAGAGTGGGAGCAAGG - Intronic
1078550593 11:12277521-12277543 AAAGGACAGCAAAGGGAGAAGGG + Intronic
1078650843 11:13190841-13190863 ATATGGCAAGAGAGGGAGCAAGG + Intergenic
1079279626 11:19075648-19075670 AAATGAGAACAGAGGCAGAATGG - Intergenic
1079307649 11:19337805-19337827 AGATTATAAAAGAGGGAGCAGGG - Intergenic
1079491176 11:20990684-20990706 AAATGACAGCTCAGGGAGAAAGG - Intronic
1081565942 11:44261329-44261351 AAATGACAGGAGATGGGGCACGG + Exonic
1081820023 11:45983758-45983780 AAATGACTTCAGAGGGACCCCGG + Intronic
1082284189 11:50301781-50301803 AAGAGGCAGCAGAGGGAGCAGGG - Intergenic
1082706530 11:56499523-56499545 AGATGACAACTGAGTGTGCAAGG + Intergenic
1083250318 11:61462689-61462711 AAATGACAACAGGCTGGGCACGG - Intronic
1083418533 11:62540671-62540693 AAATAAAAAAAGAAGGAGCAGGG + Intronic
1084805426 11:71575651-71575673 AAATAACAACAGAGAAAGGATGG - Intergenic
1085878278 11:80434795-80434817 AAAAAACAAGAGAGAGAGCAGGG - Intergenic
1086774758 11:90816411-90816433 ATATGGCAAGAGAGGGAGCAAGG + Intergenic
1087361256 11:97162453-97162475 AAAAGAAAACTGAGGTAGCAAGG - Intergenic
1089315163 11:117586527-117586549 AACTGAGAACAGAGAGAGCTGGG - Intronic
1089797588 11:120994628-120994650 AAATGGAAACAGAGAGAACAGGG - Intergenic
1090288722 11:125522923-125522945 AAATTAAAACAGAGGGGGCCGGG + Intergenic
1090357897 11:126152333-126152355 AAATTACAACAAATGTAGCATGG - Intergenic
1090566261 11:127995290-127995312 AAATGGCAGCAGAGGAAGCAAGG + Intergenic
1091181378 11:133607484-133607506 AAATAACAACAGAGAGAGAGAGG + Intergenic
1092080789 12:5714330-5714352 AAATTAGAACAGAGAAAGCAGGG + Intronic
1092224305 12:6737175-6737197 AAATGACACCAAAGGAAACACGG + Intergenic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092505093 12:9090516-9090538 GAAGGAGAACAGAGGGAGAATGG + Intronic
1092576364 12:9787616-9787638 TAAAGACAAAAGAGTGAGCAGGG + Intergenic
1092599666 12:10045725-10045747 AAATGACATCAAAGGAAGAAAGG - Intronic
1092822699 12:12367977-12367999 AAATGAGAACAGAGAAAGCGTGG - Intronic
1092826092 12:12400351-12400373 ACATGACAAAAGAGTGGGCATGG + Intronic
1092851682 12:12634396-12634418 TTATGACATCAGTGGGAGCAGGG + Intronic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093428279 12:19054216-19054238 AAAAGACAAGAGAGGCAACATGG - Intergenic
1093698368 12:22189165-22189187 ACATGGCAAGAGTGGGAGCAGGG - Intronic
1093905889 12:24691436-24691458 ACATGGCAAAAGAGAGAGCAAGG + Intergenic
1094110059 12:26853121-26853143 AAAGGACAAGAGAGGAAGCAAGG + Intergenic
1094188609 12:27672736-27672758 AAATGAAAACTGATGAAGCAAGG - Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094705555 12:32911111-32911133 AAATGTCAACACAGGGAAAAAGG - Intergenic
1095651303 12:44612935-44612957 AAATGACAACAGAGGAAACCAGG - Intronic
1096267726 12:50137328-50137350 AAGGGAGAACAGAGAGAGCAAGG + Intronic
1096380793 12:51156323-51156345 ACATGGCAACAGAGGAAGCAAGG + Intronic
1098489779 12:71061769-71061791 AAAGAACTCCAGAGGGAGCATGG + Intronic
1098566354 12:71941607-71941629 AAATGACGACAAAGGCAACAAGG + Exonic
1099369157 12:81809207-81809229 TAATGACAACAGAAGAAGCCTGG + Intergenic
1099446849 12:82762693-82762715 AAATAAAAACACAGGGAGAATGG + Intronic
1100807781 12:98305257-98305279 ACAAGGCAAGAGAGGGAGCAAGG - Intergenic
1101064461 12:101004901-101004923 CAATGAAAACAGGGGGATCATGG + Intronic
1101065490 12:101016310-101016332 AGATGGCAAGAGTGGGAGCAAGG + Intronic
1101089417 12:101270036-101270058 AAAGGAAAACAGAGGGGACAGGG - Intergenic
1102080208 12:110091673-110091695 AACTGAAAACATAGGAAGCATGG - Intergenic
1102829372 12:115982521-115982543 AAATGACAACAGCTGGAGGGTGG + Exonic
1103462574 12:121116835-121116857 AACTGAGAACACAGGAAGCATGG + Intergenic
1104231004 12:126883956-126883978 ACATGAGAACAGAGCCAGCAGGG - Intergenic
1104250903 12:127092831-127092853 AAATGAGAACAGGGAGAGAATGG + Intergenic
1104379319 12:128293165-128293187 AAATGAGACCAGAGGGAGTTTGG - Intronic
1104514320 12:129410207-129410229 AAATGACCACAGAGGGACAGGGG + Intronic
1104718902 12:131033762-131033784 AAATGACCACAGAGGACACACGG - Intronic
1104998711 12:132674907-132674929 AAATGCCAACAGAAGGAGGCTGG - Intronic
1105811250 13:23997716-23997738 ACATGGCAAGAGAGGGAACAAGG + Intronic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1106216483 13:27706448-27706470 AAATGAAAAAAGAGGGAGGCAGG - Intergenic
1106842116 13:33694983-33695005 AAATGCCAAAAGATAGAGCAAGG + Intergenic
1108494671 13:51013115-51013137 GAATGAGAACAGAGTGAGAATGG - Intergenic
1108770375 13:53693504-53693526 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1109582900 13:64364956-64364978 AAATGACAACAGAATGAGTCCGG - Intergenic
1112402811 13:99090123-99090145 TAAAGTCATCAGAGGGAGCATGG + Intergenic
1112429423 13:99337642-99337664 AGAAGACAACAGAGGGAATATGG - Intronic
1112718174 13:102211043-102211065 AAATGAGAATAAAGGGAGGAGGG - Intronic
1113432712 13:110264454-110264476 TAAGAACAACAGAGGGAGGACGG + Intronic
1113630027 13:111876009-111876031 AAATGAGAACAGAGTGAGATGGG + Intergenic
1114033137 14:18593844-18593866 ACATGGCAAGAGAGGGAGAAAGG - Intergenic
1114125806 14:19723921-19723943 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1114186384 14:20405609-20405631 AAATGAGAAGAGAGGTAACAAGG + Intronic
1114824072 14:26055663-26055685 AAATAACAAGAGAGGGAGGGAGG + Intergenic
1115178169 14:30590031-30590053 AAATGATAACTGAATGAGCAAGG - Intronic
1115696800 14:35908193-35908215 AAATGATAAAAGAAGGACCATGG + Intronic
1116297536 14:43132597-43132619 ACATGAGAACAGAGGCTGCATGG - Intergenic
1117575147 14:57090544-57090566 AAAAGAAAACAGAGTGAGAAAGG - Intergenic
1118862367 14:69674419-69674441 AAATGAGTACAAAGGAAGCAGGG - Intronic
1119250502 14:73148975-73148997 AAAAGAAAAGAGAGAGAGCATGG + Intronic
1119472032 14:74906372-74906394 AAATCACAAGATAGGGGGCATGG + Exonic
1120002515 14:79318572-79318594 ACATGACAACAGCTGGAGAATGG - Intronic
1120680111 14:87471115-87471137 AAAAGCCTTCAGAGGGAGCATGG - Intergenic
1121998198 14:98623002-98623024 AAATCACAACAGTGGTTGCAGGG + Intergenic
1122193758 14:100068946-100068968 CAAAGACAACAGAGAGACCAGGG - Intronic
1122264280 14:100539454-100539476 AAATCACACCAGGGGGAGCCTGG + Intronic
1124062547 15:26307470-26307492 AAGTGATACCACAGGGAGCAGGG - Intergenic
1124205733 15:27718473-27718495 AAATGACAACAGAGAAGCCAAGG + Intergenic
1126218157 15:46181424-46181446 ACATGGAAAGAGAGGGAGCAAGG + Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127014125 15:54664409-54664431 AGCTGACAAAACAGGGAGCATGG + Intergenic
1127121431 15:55775440-55775462 AAGAGACTACAGAGGGAGCCTGG - Intergenic
1127761824 15:62146861-62146883 AAATGACAAGAGAAGAATCATGG - Intergenic
1129173646 15:73823585-73823607 ACATGGCAAAAGTGGGAGCAAGG + Intergenic
1130385308 15:83406402-83406424 AGATCACAACAGAGGGAGACTGG - Intergenic
1131776499 15:95806580-95806602 ATATGCTAACAGAGGGAACATGG + Intergenic
1132338725 15:101064917-101064939 ACATGACAGCAGTGGGGGCATGG - Intronic
1133420599 16:5643170-5643192 AAATGACATCAGAAGCAGGAGGG + Intergenic
1133547504 16:6822005-6822027 ACATGACCAAATAGGGAGCATGG + Intronic
1133604483 16:7372758-7372780 AAAGGAGAAGAGAGGGAGAAAGG + Intronic
1135172585 16:20199720-20199742 TGCTGACAAGAGAGGGAGCAAGG + Intergenic
1135187699 16:20329437-20329459 AAATGGGAGCAGAGGGAGAAAGG - Intergenic
1135547836 16:23377671-23377693 AAATGAGAAGGGAGGGAGAAAGG - Intronic
1135573639 16:23568139-23568161 AAAAGACTACAGAGAGAGTAGGG - Intronic
1135824413 16:25713901-25713923 GAGAGACAACAGAGGTAGCAAGG - Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1136479332 16:30532172-30532194 AAAAGACAACAGAGAAAACAAGG + Intronic
1136574397 16:31114912-31114934 AAAAGAAAAAAGAGGGAGGAAGG - Intergenic
1137407339 16:48199964-48199986 AAATGAAAACAGGCCGAGCACGG - Intronic
1137820392 16:51439129-51439151 AAAAGAAAAAAGAGGGAGGAAGG + Intergenic
1138736176 16:59252505-59252527 AAAAGACACAAGAGGGAGCAGGG + Intergenic
1140067164 16:71621383-71621405 ACATGTCGAGAGAGGGAGCAAGG + Intergenic
1140691621 16:77490014-77490036 AAATGACTAGAGAGGAAGGAAGG + Intergenic
1141125255 16:81396589-81396611 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1141426651 16:83948780-83948802 AAAAGACAACAGAGGTTCCAGGG - Intronic
1142357404 16:89608403-89608425 AAGTGACTCCAGAGGGAGCCGGG - Intergenic
1142786964 17:2231899-2231921 AGAGGAAAACAGAGGGAGCCAGG + Intronic
1144066150 17:11625872-11625894 TAATGACATCAGAGTGATCATGG + Intronic
1144452407 17:15391854-15391876 ACATGACAAGAGTGGGAGCAAGG - Intergenic
1146039197 17:29434774-29434796 AAATGACAACAGAGGTTAAAAGG - Intronic
1147261687 17:39212765-39212787 GAATGACATTAGAGGGAGCTTGG - Intronic
1147343964 17:39774529-39774551 TAATGTCAACGGAGGGAGAAAGG - Intronic
1149560540 17:57605061-57605083 AAATGGCAACAGAAGCAGAATGG - Intronic
1151352752 17:73541373-73541395 AGATGACATCAGAAGGACCAAGG + Intronic
1152315888 17:79579989-79580011 AGATGACAACTGAGGGTGAATGG - Intergenic
1153122843 18:1751447-1751469 AAATAACAACAGAGAGAGGCAGG - Intergenic
1153558367 18:6342643-6342665 AAATGGCAACAGAGGAAGAAAGG + Intronic
1155107949 18:22686425-22686447 ACATGGCAAAAGAGGGAGCAAGG + Intergenic
1155829389 18:30493635-30493657 ACATGGCAATAGAAGGAGCAAGG - Intergenic
1156637675 18:39050648-39050670 AAAAGAGAAGAGAGGAAGCAAGG - Intergenic
1156698560 18:39796453-39796475 AAATGACAACAGAGGTTAAAAGG - Intergenic
1156736369 18:40264100-40264122 ACATGGCAAGAAAGGGAGCAAGG - Intergenic
1157051045 18:44165089-44165111 AAATGATAAAAGAGGTAACAAGG + Intergenic
1159688119 18:71449105-71449127 AAATGACATCAGAGAAAGAATGG - Intergenic
1161041049 19:2110968-2110990 TAATGACCACAGAGGCAGCAGGG + Intronic
1162879622 19:13648649-13648671 AAATGACAACACAGAGAAAAAGG - Intergenic
1163048348 19:14661917-14661939 AAACAACAACAGAGGAAGGAAGG + Intronic
1163203836 19:15787840-15787862 AAAAGAAACGAGAGGGAGCATGG + Intergenic
1163627983 19:18401880-18401902 AGTAGACAGCAGAGGGAGCAGGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1167109333 19:47449753-47449775 TGATGACAGCAGAGGGAGCCAGG + Intronic
1167676466 19:50889520-50889542 AAATAACAGAAGAGGGAACAAGG - Intergenic
1167676487 19:50889636-50889658 ACATGACAGAAGAGGGACCAAGG - Intergenic
1167734906 19:51288150-51288172 AAATGACATGGGTGGGAGCATGG + Intergenic
1168192673 19:54751208-54751230 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168194761 19:54766036-54766058 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168197011 19:54782481-54782503 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168200596 19:54812688-54812710 ACATGGCAAGAGAGGGAGAAAGG + Intronic
1168202807 19:54828920-54828942 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168207835 19:54865359-54865381 ACATGGCAAGAGAGGGAGCAAGG + Intronic
925889755 2:8424114-8424136 ACATGACAAAAGCAGGAGCAAGG + Intergenic
927848380 2:26483744-26483766 AAGGGACAGCTGAGGGAGCAAGG + Intronic
928207370 2:29295739-29295761 AAATGAGGACAGAGGGCTCAAGG - Intronic
928595895 2:32858521-32858543 AAATGTCAACACAGTGAACAAGG - Intergenic
928868020 2:35941639-35941661 AAATGAAAACAGAGGGGTTATGG + Intergenic
929372171 2:41239087-41239109 AAATGAAAACAAAGAGAGAATGG - Intergenic
929456153 2:42067474-42067496 AAATGACTATAGAGCCAGCAGGG + Intergenic
930705722 2:54502965-54502987 TCATGACCACAGAGGGAACATGG - Intronic
931861870 2:66363216-66363238 AAATGATAAAAGAGGAAACATGG + Intergenic
931887593 2:66633802-66633824 AACTGAAAAAAAAGGGAGCAGGG - Intergenic
932093283 2:68825468-68825490 AAATGACAAATGAGGGGGCTGGG + Intronic
932194691 2:69773332-69773354 AAATGACAAGTGAGGAGGCAGGG - Intronic
932668608 2:73718106-73718128 AAAAGGGAACAGAGGGAGGAGGG - Intergenic
932997471 2:76872896-76872918 ATTTGGCAAGAGAGGGAGCAAGG - Intronic
934164477 2:89281730-89281752 AAATGACGACAGCAGGAGAATGG + Intergenic
934202797 2:89900794-89900816 AAATGACGACAGCAGGAGAATGG - Intergenic
935055367 2:99561786-99561808 AAATGACAAAAGAAGGAATATGG - Intronic
936248139 2:110846300-110846322 AAATGACAATACTGGGAGGATGG + Intronic
936909744 2:117577853-117577875 AAAGGATAACAGAGAGAGAAAGG + Intergenic
937727732 2:125187003-125187025 AAATGACAACAGAGGTTAAAAGG - Intergenic
938235739 2:129705283-129705305 AGATGACCAGAGAGGGGGCAGGG + Intergenic
939551062 2:143616619-143616641 GAATTACGACAGAGGGAGGAAGG - Intronic
940695801 2:156976821-156976843 AAATGGCAACAAAAAGAGCAAGG - Intergenic
940750092 2:157616108-157616130 AGAAGAAAACAGAGGGAGAATGG - Intronic
941088985 2:161152338-161152360 AAATGAAAGCAGAAGGAGCTTGG - Intronic
941362978 2:164575526-164575548 AGATGAAAGCTGAGGGAGCAAGG + Intronic
941918606 2:170828317-170828339 AGATGACAGCAGAGGGAAGAGGG - Intronic
941929751 2:170928263-170928285 AAATGACACCACAGGGAACCAGG - Intergenic
944288754 2:197980015-197980037 AAATGACAACATTGAGGGCAGGG + Intronic
944409497 2:199424708-199424730 AAAAGACAAAATAGGAAGCAGGG + Intronic
945439938 2:209865989-209866011 AAGTGACTACAGTGGGAGGAGGG - Intronic
945665405 2:212735122-212735144 AAATGACAACAGAAAAAGCAAGG + Intergenic
947008276 2:225537168-225537190 AAATGAAGACAGAGAGAGAAGGG - Intronic
947109017 2:226698714-226698736 AAGTGACAAAAGAGGGAGTGGGG - Intergenic
947413787 2:229871528-229871550 ACATGGCAAGAGTGGGAGCAAGG - Intronic
947660303 2:231861633-231861655 ACAGAACAAGAGAGGGAGCAGGG + Intergenic
947859039 2:233345743-233345765 AAGCGACATCAGAGGGGGCAAGG + Intronic
1169595490 20:7193838-7193860 AAATGGCATCAGAAGCAGCAAGG - Intergenic
1169978524 20:11357605-11357627 AACTGAACAGAGAGGGAGCAGGG + Intergenic
1170073533 20:12394854-12394876 AAGTGACAAAAGAGTGAGAACGG - Intergenic
1170194987 20:13680505-13680527 AAGTGAGAACATAGAGAGCAAGG - Intergenic
1170527489 20:17255029-17255051 AATTGACAAAAGAGTCAGCAAGG - Intronic
1171727087 20:28634051-28634073 AAATGACATCAGAACCAGCATGG - Intergenic
1171858384 20:30371761-30371783 AAATGTCATCATAGGGAGCCAGG - Intergenic
1172435145 20:34923678-34923700 ACATGGCAAGAGAGGAAGCAAGG + Intronic
1173399174 20:42709430-42709452 ACATGGCAAGAAAGGGAGCAAGG - Intronic
1173846530 20:46192096-46192118 AAATAAAAACAGAGGGTGCTGGG - Intronic
1174617592 20:51847868-51847890 AAATGGCAATAAAGGAAGCATGG - Intergenic
1174766742 20:53261484-53261506 AAATGAGAACTGAGGAAACAGGG + Intronic
1175605197 20:60307091-60307113 AAAGCAAACCAGAGGGAGCAGGG + Intergenic
1176074586 20:63242753-63242775 ACATGACAGCAGAGGGAACATGG + Intronic
1177059619 21:16354507-16354529 AAATGAAAACAGATGGTACAGGG - Intergenic
1178260278 21:31093425-31093447 ACATGACAAGACAGGGAGGAAGG - Intergenic
1178350561 21:31870527-31870549 AAGAGACAACAGAGGGAGATGGG + Intergenic
1178785404 21:35648842-35648864 AAGTGAGATCAGAGGGAGAATGG - Intronic
1179095643 21:38312248-38312270 AAAATACCTCAGAGGGAGCATGG - Intergenic
1180457249 22:15520899-15520921 ACATGGCAAGAGAGGGAGAAAGG - Intergenic
1182068470 22:27446553-27446575 CCATGACAAGAGAGGCAGCATGG + Intergenic
1182113576 22:27742073-27742095 AAAGGAGAAAAGAGGGGGCAGGG - Intergenic
1183554306 22:38513253-38513275 CAGTGACAGCAGGGGGAGCAGGG - Intergenic
1183696182 22:39424415-39424437 AAATCAGAACACAGGGAACAGGG - Intronic
1184319454 22:43729071-43729093 AAGTGGCAAGAGAGGGAGCAAGG + Intronic
1184768176 22:46582919-46582941 AAAAGACAAAAGAGAGAGAAAGG - Intronic
1184815177 22:46863468-46863490 AAATGGCATCAAAGAGAGCAGGG - Intronic
1184899610 22:47436758-47436780 ACATGGCAAAAGAGGGAGGAAGG - Intergenic
1184932879 22:47694065-47694087 AAATGACAACAGTCGCAACAAGG + Intergenic
950441303 3:13012283-13012305 AAATGGCAACTGAGGGAGCAGGG - Intronic
950837605 3:15935774-15935796 AAAAGGAAACAGAGGGAGCAAGG - Intergenic
951682006 3:25304709-25304731 TAAGGACAAGAGTGGGAGCAAGG - Intronic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
952890619 3:38037730-38037752 AAAGGACAAAAGAGAGAGCCAGG + Intergenic
953143421 3:40250338-40250360 ACATTCCAACAGAGGGAGAAAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953569533 3:44060081-44060103 AAGTGAAAAGAGAGGCAGCAAGG - Intergenic
954504077 3:51051845-51051867 ACATGGCAAGAGTGGGAGCAAGG + Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
954944069 3:54402195-54402217 AAAAAACAAGAGAGGGAGAAGGG + Intronic
956857533 3:73290252-73290274 CAATGACAAGAGAGGCAGCATGG + Intergenic
957426567 3:80047135-80047157 AAATGACGACACAGAGAGTAAGG + Intergenic
957444411 3:80296425-80296447 ACATGGCAAGAGAGGAAGCAAGG + Intergenic
957700894 3:83710139-83710161 AAATGAAAACAGAGATAGGAAGG + Intergenic
957899773 3:86474112-86474134 ACATGGCAAGAGAGGAAGCAAGG - Intergenic
957909812 3:86606816-86606838 ATATGGCAAGAGAGGCAGCAAGG + Intergenic
958129174 3:89395751-89395773 GAATAAGAACAGAGGGAGAAGGG - Intronic
958164777 3:89866567-89866589 AAATGATAATAGAGGGAGAAAGG - Intergenic
958446147 3:94217501-94217523 AATTGAAAACAGAAGAAGCAGGG + Intergenic
958532796 3:95355522-95355544 AAATGACTACAGAGACAGCATGG - Intergenic
959679545 3:109077712-109077734 AAATAACAACAAAAGAAGCAAGG + Intronic
960592233 3:119377570-119377592 AAATGACGGGAGACGGAGCAGGG + Intronic
960912282 3:122661471-122661493 TAATGACTACAGAGGAGGCAGGG + Intergenic
961038875 3:123663158-123663180 ACATGACAACAGCGGGAGACTGG + Intronic
962141350 3:132793877-132793899 ACATGGCAAGAGGGGGAGCAAGG + Intergenic
962979865 3:140478763-140478785 AACTGAAAAAAGAGGGAGGAAGG + Intronic
963825808 3:149951986-149952008 GAATGACAAGAGAAGGAGAATGG - Intronic
964705167 3:159610547-159610569 TAATGAAAACAGAGGGAGGTAGG - Intronic
965028056 3:163328156-163328178 AAATGACAACAGAGGTTTAAAGG + Intergenic
965553804 3:169999053-169999075 ATAAGACAGCAGAGTGAGCATGG + Intergenic
965582029 3:170278826-170278848 ACATGGCAAGAGAGGGAGCAAGG + Intronic
966041374 3:175493144-175493166 AAATGATAACAGTGGGGTCATGG + Intronic
966532029 3:180991742-180991764 AAAAGACAAAAGAGGGGGTAGGG + Intergenic
967514563 3:190351122-190351144 ATATGGCAAGAGAGGGACCAAGG - Intronic
967521661 3:190439377-190439399 AATTTACAATAGATGGAGCAGGG - Intronic
968163953 3:196449228-196449250 AAATGACAGCAGAGGGACCGAGG + Intergenic
969789317 4:9481124-9481146 ATATGACAGCAAAGGTAGCAGGG - Intergenic
970035890 4:11735444-11735466 AAAGGCTAACACAGGGAGCAGGG + Intergenic
973181214 4:47270679-47270701 CCATGACAACAGTGGGAGCTTGG + Intronic
975336142 4:73177543-73177565 AAATGCAAAAAGAGGGAGGAAGG + Intronic
976345256 4:83993058-83993080 AAATGACAACAGAGGTTAAAAGG + Intergenic
976410405 4:84706771-84706793 AAATTACAAGAGAGGGAACTGGG + Intronic
976589479 4:86834870-86834892 ACATGGCCAGAGAGGGAGCAAGG + Intronic
976847853 4:89510713-89510735 ACATGGCAAAAGAGGCAGCACGG - Intergenic
977007007 4:91580284-91580306 GAATGTCAACATAGTGAGCAGGG - Intronic
977034863 4:91936581-91936603 AAATGACAGAAGACTGAGCATGG - Intergenic
977124107 4:93142399-93142421 AGATGACCACTGAGGAAGCAGGG - Intronic
977837049 4:101657350-101657372 AAATCACAGCAGAGGGCTCACGG - Intronic
977956284 4:103030594-103030616 AGAAGACAAGAGAGGTAGCATGG + Intronic
978530373 4:109706493-109706515 AAATGACAACAAAGGATTCAGGG + Intergenic
979190814 4:117856092-117856114 AAATGGCACCAGAGGAATCAGGG - Intergenic
979309317 4:119183796-119183818 AAAAGACAACAGTGGAAGGAGGG - Intronic
979752167 4:124291981-124292003 ACATGGCAAGAGAGGGAGCGGGG - Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
981215973 4:142168271-142168293 AAATGACAAAAAAGGGAGAGAGG - Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
983989602 4:174101577-174101599 AAATGAAAAGAGAGGGAGTAAGG + Intergenic
984285824 4:177727362-177727384 AAATGAAAACAGAGGAAGAGAGG - Intergenic
984901352 4:184589604-184589626 AAATGAGAAAAAAGGGAGCTAGG + Intergenic
984942230 4:184943063-184943085 ATATGGCGAGAGAGGGAGCAAGG + Intergenic
986631610 5:9779209-9779231 ACATGACAAGAGATGGAGCAAGG - Intergenic
986828845 5:11552061-11552083 AAATAAAGACAGAGGCAGCAGGG - Intronic
988835997 5:35032830-35032852 AAATGACAAAAGAAGGAGTGTGG + Intronic
988899706 5:35718792-35718814 AAATGACAACAGAGGTTAAAAGG - Intronic
989602007 5:43209100-43209122 AAATAAAAACAGAGGGAAAATGG + Intronic
990227883 5:53676775-53676797 AAATGACCACAGAAGCACCATGG + Intronic
990434969 5:55780648-55780670 ATTTGGCAACAGTGGGAGCAAGG + Intronic
990763402 5:59155693-59155715 AAAGGAAAACAGACGAAGCAAGG + Intronic
991037263 5:62140366-62140388 AAAGGACAACAGATGGAACCAGG + Intergenic
991317613 5:65327144-65327166 ACATGGCAAGAGAGGGAGCAAGG - Intronic
991534239 5:67648991-67649013 CAATGACAACAGAGTGAAGAGGG - Intergenic
992408303 5:76480387-76480409 AAATGATAATTGAGGGAGAAAGG - Intronic
992558030 5:77922247-77922269 ATATGACAAGACAGGGAGCACGG - Intergenic
993377393 5:87165296-87165318 AAAAGAAATCAGAGTGAGCAGGG + Intergenic
994200576 5:96970549-96970571 AAATGAAAACAGTGGCAACATGG - Intronic
995561676 5:113388585-113388607 ACATAGCAAGAGAGGGAGCAAGG - Intronic
995782189 5:115789308-115789330 ACATGGCGAGAGAGGGAGCAAGG - Intergenic
995853124 5:116567594-116567616 AAATGAAAACTGAAGGAGAAAGG + Intronic
996407048 5:123115849-123115871 AAATGAGGAGAGAGGGATCAGGG - Intronic
997447061 5:133948252-133948274 ACATGACAAGAGAGGGAACAAGG + Intergenic
997457031 5:134025245-134025267 ACATGGCGAAAGAGGGAGCATGG + Intergenic
998860713 5:146441000-146441022 AGAAGAGAATAGAGGGAGCAAGG + Intergenic
999076855 5:148804509-148804531 AAATGACAGCAGGGGGAGGAGGG + Intergenic
999400792 5:151262800-151262822 TGATGGCAGCAGAGGGAGCATGG - Intronic
999425701 5:151486194-151486216 ATATGGCAAGACAGGGAGCAAGG + Intronic
999621656 5:153480433-153480455 CAATGGCAACAGAGGGACTAAGG - Intergenic
1000348901 5:160337342-160337364 CAATGACAAAAGAGGGAGACAGG - Intronic
1000391352 5:160726621-160726643 AAAGGGAAACAGAGAGAGCAAGG + Intronic
1000945156 5:167413372-167413394 AACTCACCACAGAGTGAGCATGG + Intronic
1001838916 5:174856593-174856615 ACATGACAAGAGAGGAGGCAAGG + Intergenic
1002630811 5:180575740-180575762 AAATGAATGCAGAGGGAGCTTGG + Exonic
1003323608 6:5075044-5075066 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1003585300 6:7383131-7383153 AAATGACGACAGGAGGGGCAGGG - Intronic
1003938286 6:10998090-10998112 ACATGGCAAGAGAGGGAGCAAGG - Intronic
1005582226 6:27246255-27246277 GAGTGACAACAGAAGGATCAGGG + Intergenic
1005717427 6:28563961-28563983 AAAGGCCAACAGATGGAGGAAGG + Intergenic
1005764724 6:28999745-28999767 AAATGAGATGAAAGGGAGCATGG + Intronic
1006183196 6:32166265-32166287 AGGTGACAACAGAGGGGGTAGGG + Exonic
1006460980 6:34157940-34157962 CAATGACCCCAGAGAGAGCAAGG + Intergenic
1006952230 6:37832283-37832305 AAAGGAGAAGAGAGGCAGCAGGG + Intronic
1008262593 6:49385465-49385487 GAATGGAAACAGAGGAAGCAAGG + Intergenic
1008836081 6:55832189-55832211 AAATGACCCAAGAGGCAGCATGG - Intronic
1008972261 6:57383277-57383299 AAATGTCAACAGAGAGAATATGG - Intronic
1009161176 6:60284814-60284836 AAATGTCAACAGAGAGAATATGG - Intergenic
1009973123 6:70645621-70645643 AAATGAGAACAGAGAGAGGGTGG + Intergenic
1010206364 6:73325977-73325999 AAATGACAACTAGGAGAGCACGG + Intergenic
1010449296 6:75984852-75984874 ACATGGCAAGAGTGGGAGCAAGG - Intronic
1011694468 6:89899562-89899584 AGATAACAACAGAGGGAGCCAGG + Intergenic
1012620131 6:101333980-101334002 AAATGATAACAGAGGAAACTTGG - Intergenic
1012724884 6:102798668-102798690 AATTGACACCGGAGGGGGCAGGG + Intergenic
1013273011 6:108560180-108560202 AGATGGCAGCAGCGGGAGCAAGG + Intronic
1013276106 6:108586300-108586322 AAATGAAAACAGAAGTAGCGTGG + Intronic
1013533376 6:111040726-111040748 AAATGAAAAAAGAAGGAGGAAGG + Intergenic
1013751703 6:113414687-113414709 AATTACCAACAGAGGGAGCCTGG + Intergenic
1015075860 6:129156958-129156980 AAATGGCAACAGAGGAATCCTGG + Intronic
1015093639 6:129388487-129388509 GAATGACAACAGATAGAGAAAGG - Intronic
1016162097 6:140894710-140894732 AGATGACAACAGAGGTTACAAGG - Intergenic
1017283965 6:152653222-152653244 AAATGACAACAGAAATAGGAGGG - Intergenic
1017350119 6:153430530-153430552 ACATGGCAAGGGAGGGAGCAAGG - Intergenic
1017821536 6:158052561-158052583 ATATGACGAGGGAGGGAGCAAGG + Intronic
1017930080 6:158944562-158944584 ACATTGAAACAGAGGGAGCATGG - Intergenic
1018554148 6:165033325-165033347 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1018595052 6:165470185-165470207 ACATGACCAGAGAGGAAGCAAGG + Intronic
1020167124 7:5816383-5816405 AAATGCCAACAGAGAGAGGGAGG - Intergenic
1020899579 7:13988920-13988942 AAATGAGAAGGGAGGGGGCACGG - Intronic
1021853865 7:24834379-24834401 AAATGAAACCGGAGGGAACAGGG + Intronic
1023255693 7:38310416-38310438 AAATGACAAGGGAGGGAAGAGGG - Intergenic
1026358977 7:69585389-69585411 ACATGGCAACAGTGGGAGCAAGG - Intergenic
1028216521 7:88140066-88140088 ACATGGCAAGAGAGGGAGCAGGG + Intronic
1028372113 7:90104102-90104124 AAATGAGAATAGAGGGAGAAAGG + Intergenic
1028792193 7:94865550-94865572 ACATGGCAAGAGTGGGAGCAAGG - Intergenic
1029036180 7:97524661-97524683 AAATGGCAAGAGAGGGAGCAAGG + Intergenic
1029353466 7:100032415-100032437 AAATGACAACAGAGGGAGCATGG - Intronic
1031865816 7:127037637-127037659 AAAGGAGGATAGAGGGAGCAAGG + Intronic
1032633071 7:133674866-133674888 AAATGACATCCCAGTGAGCATGG - Intronic
1032797389 7:135288832-135288854 AACTGAGAACAGAGGGGTCATGG - Intergenic
1033785096 7:144720579-144720601 AAATCAAAACAGAGGAAGCCTGG + Intronic
1033897650 7:146094450-146094472 AAATGCAAGCAGATGGAGCAGGG + Intergenic
1034514811 7:151567527-151567549 TAATAGGAACAGAGGGAGCATGG - Intronic
1035816984 8:2551716-2551738 AAATGCAAACAGAGCGGGCATGG + Intergenic
1035967471 8:4209549-4209571 AAATGCCAGAAGAGGCAGCATGG - Intronic
1035975577 8:4307065-4307087 AATTGGCAATAGTGGGAGCAGGG - Intronic
1036416046 8:8549574-8549596 TAATTACAACAGAGAGAGGAAGG + Intergenic
1037747285 8:21656399-21656421 AAATGACAACAAAGAAATCACGG - Intergenic
1038061378 8:23917598-23917620 CAGTGACAACAGAGGAAACAAGG - Intergenic
1038278521 8:26141866-26141888 ACATGGCCAGAGAGGGAGCAAGG - Intergenic
1038403947 8:27308032-27308054 AAGTGACAACAGATGCAGAACGG + Intronic
1038630772 8:29241570-29241592 AAATGTCAACACAGTGAGAAAGG - Intronic
1039166657 8:34688565-34688587 AAATGCCATAAGAGGGAGAAAGG - Intergenic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1040871784 8:52107166-52107188 ACATGGCGACAGAGGAAGCAGGG + Intergenic
1040903080 8:52437439-52437461 GAAGAACAACAGAGGCAGCAGGG + Intronic
1042543050 8:69926136-69926158 AAATGACAAAAGAGCAAACAAGG + Intergenic
1042836885 8:73087105-73087127 AAACACCAACAGAGTGAGCAAGG - Intronic
1044808036 8:96028944-96028966 AAATGAAAAAAGAGTGTGCAGGG - Intergenic
1045209012 8:100075354-100075376 ACATGGCAAGAGAGGTAGCAAGG - Intronic
1045371365 8:101527072-101527094 AAATGTCAACAGAGGGAATAAGG + Intronic
1045598485 8:103685313-103685335 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1046843523 8:118888146-118888168 AAATGGTAACTGAGAGAGCAGGG + Intergenic
1048664741 8:136648199-136648221 AAATGACTGTGGAGGGAGCAGGG + Intergenic
1049151281 8:141037041-141037063 AAAAAAAAAAAGAGGGAGCACGG - Intergenic
1049185251 8:141247863-141247885 AAATGCCAACAGAGGTGCCATGG + Intronic
1049233937 8:141499480-141499502 AAATGACAACAGATGGAAATAGG + Intergenic
1049304155 8:141890669-141890691 ACATGGCAAAAGTGGGAGCAAGG + Intergenic
1049341384 8:142114425-142114447 GAATGAGAAGAGAGGGAGGAAGG + Intergenic
1050508738 9:6372412-6372434 AAATGACAACAGAGGTTAAAAGG - Intergenic
1050689748 9:8212642-8212664 AACAGACAAAAGAGGTAGCAGGG + Intergenic
1051059263 9:13027362-13027384 AAATGTCAACAGGGAGAGCAGGG + Intergenic
1052230573 9:26146000-26146022 AAAAGAAAAAAGAGGGAACAGGG + Intergenic
1052249481 9:26380515-26380537 AAATGACAGCACAGGGAGACTGG - Intergenic
1052514069 9:29457226-29457248 AAATGAAGACAAAGGGAGAAGGG + Intergenic
1052966575 9:34345011-34345033 AAGTCACAACAGAGAGAGGAGGG + Intergenic
1054710307 9:68504432-68504454 AAATGAGGTCAGAGGGAGAAGGG - Intronic
1055185695 9:73450734-73450756 AAATTAGAAAAGAGGCAGCATGG - Intergenic
1055863703 9:80786758-80786780 AAATGAGAACAAAGGAAACAGGG + Intergenic
1056052492 9:82784042-82784064 AAAAAGCGACAGAGGGAGCACGG - Intergenic
1056117176 9:83452026-83452048 AGATGTCAACAGAGGGAGACTGG + Intronic
1056275435 9:84990317-84990339 AAATGACATCAGAGGAAAAAAGG + Intronic
1056841577 9:90002254-90002276 AAATGTCAACAGAGGTAGATAGG + Intergenic
1057016378 9:91656355-91656377 AAATCAAAAAAGAGGGAGGACGG + Intronic
1057045454 9:91882789-91882811 ACGTGAAAACAGAGGGAGAAAGG + Intronic
1057330668 9:94111974-94111996 AAATGAAAACAGACTGGGCACGG + Intergenic
1057439560 9:95073134-95073156 GCAGGACAGCAGAGGGAGCAGGG - Intronic
1057716076 9:97497429-97497451 AAATGAGAACAGAAAGAGGAAGG + Intergenic
1058341632 9:103904552-103904574 ACATGGCAAGAGAGAGAGCAAGG - Intergenic
1058553054 9:106136328-106136350 AGATGAGAGCAGAGGGACCACGG + Intergenic
1059168682 9:112103911-112103933 AAATGGCTCCAGATGGAGCATGG - Intronic
1059265664 9:113027585-113027607 AAATGACTATAGAAGGGGCATGG + Intergenic
1060454032 9:123773121-123773143 AAATAAGAGCAGAGGGGGCAGGG + Intronic
1061454483 9:130687511-130687533 ACATGAAAACAGAGGCAGCAGGG - Intergenic
1061848797 9:133402807-133402829 CAAGGACAACAGAGGCAGGAAGG + Intronic
1186703345 X:12115562-12115584 AAGAGCCAACAGAGGGGGCAGGG - Intergenic
1187777651 X:22780753-22780775 AAATGACAAAAAAGGAACCATGG + Intergenic
1188504185 X:30863595-30863617 ATATGGCAAAAGCGGGAGCAAGG - Intronic
1189153318 X:38729787-38729809 AAATGACAACAGAGGTTAAAAGG + Intergenic
1189164910 X:38851200-38851222 AAATGAAAGCAGAGAGAGAATGG + Intergenic
1189276535 X:39790549-39790571 ATGTGACAAAAGAGGAAGCAAGG + Intergenic
1189640441 X:43064165-43064187 AAATAACAACAGAGACAGAAAGG - Intergenic
1189654352 X:43226439-43226461 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1190507379 X:51139466-51139488 AAATGACAACAGAAGGTGTAGGG - Intergenic
1191227640 X:58061486-58061508 AAAAAACAACACAGGGACCAAGG - Intergenic
1191899226 X:66023492-66023514 AAATGACAACAAAGTAAACAAGG + Intronic
1192124874 X:68492746-68492768 ACATGACAAAAAAGGAAGCAAGG + Intergenic
1192144554 X:68672858-68672880 AAATGAAAACATAGGAAGTAGGG + Intronic
1192227157 X:69237223-69237245 AAATGAGAACACAAGGAGGAAGG - Intergenic
1193158690 X:78203310-78203332 GAATGCCATCAGAGGTAGCAGGG - Intergenic
1193916650 X:87372752-87372774 AAATGGCAACAGATCGATCAAGG + Intergenic
1194027432 X:88770378-88770400 AAATGACAACAGAGGTTAAAAGG + Intergenic
1194066427 X:89267424-89267446 AAATGACAACAGAGGTTAAAAGG - Intergenic
1194949973 X:100114040-100114062 TAAAGACAACAGAGGCAGCAAGG + Intergenic
1195067762 X:101253018-101253040 AAACTAAAACAGAGAGAGCAAGG + Intronic
1196176502 X:112644576-112644598 ATATCACAACACAGGGAGCTAGG + Intronic
1196780854 X:119382929-119382951 ACATGGCAAGAGAGGAAGCAAGG - Intergenic
1197144095 X:123151945-123151967 AAATGAAAACAAATAGAGCAAGG + Intergenic
1197489002 X:127093068-127093090 AAATGAGAACAGAGGTAGAGAGG - Intergenic
1197493902 X:127153831-127153853 AAATGCCACCAGATGGAGGAAGG + Intergenic
1197608991 X:128617298-128617320 ACATGGCAAGAGTGGGAGCAAGG + Intergenic
1197637262 X:128929004-128929026 GAATGAGCACAGAGGAAGCATGG - Intergenic
1197852427 X:130877416-130877438 AAAGGACAGAAGAGGGAGGAAGG - Intronic
1199499848 X:148497595-148497617 AGAAGCCAACAGAGGGAGAAGGG + Intergenic
1199622660 X:149713899-149713921 GGATGAAAACAGAGGAAGCAAGG - Intronic
1200344900 X:155438393-155438415 ACATGACAAGAGAGGAAGCATGG - Intergenic
1200720597 Y:6601545-6601567 AAATGACAACAGAGGTTAAAAGG - Intergenic
1202592467 Y:26500869-26500891 AAATGGCAAGAGGGGAAGCAAGG - Intergenic