ID: 1029358595

View in Genome Browser
Species Human (GRCh38)
Location 7:100071530-100071552
Sequence CCCACATTCATTGCAGGCGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029358591_1029358595 -8 Left 1029358591 7:100071515-100071537 CCTGCTGAAGGCCTTCCCACATT 0: 3
1: 7
2: 29
3: 113
4: 351
Right 1029358595 7:100071530-100071552 CCCACATTCATTGCAGGCGTAGG 0: 1
1: 1
2: 4
3: 29
4: 216
1029358587_1029358595 30 Left 1029358587 7:100071477-100071499 CCAGTGTGGATTCTCTGATGGTG 0: 3
1: 11
2: 100
3: 291
4: 867
Right 1029358595 7:100071530-100071552 CCCACATTCATTGCAGGCGTAGG 0: 1
1: 1
2: 4
3: 29
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029358595 Original CRISPR CCCACATTCATTGCAGGCGT AGG Exonic
900790229 1:4675112-4675134 CCCACACCCATTGCTGGCCTAGG - Intronic
900862378 1:5242816-5242838 CCCAAATCCATTGCAGGTGGGGG + Intergenic
902328798 1:15720299-15720321 CCCACATTCTTTGCAGAAGGAGG + Intronic
902678896 1:18029366-18029388 CCCACCTTCTTTGCAGCCCTGGG + Intergenic
903062527 1:20679757-20679779 TCCACACTCATTTCAGGTGTTGG - Intronic
909706599 1:78592326-78592348 CCGACATTCCTTGCAGCTGTGGG - Intergenic
910665333 1:89719917-89719939 ACCACATTCACTCCAGGCTTAGG + Intronic
912318361 1:108687146-108687168 CTCACATTCATTAAAGGCTTTGG + Intergenic
918730622 1:187990086-187990108 CACACATTCTTTGCATTCGTTGG + Intergenic
920929270 1:210371494-210371516 CCCACATTCTTTGGAGGGGCTGG + Intronic
924773841 1:247100833-247100855 CCCACATTCCTTACATTCGTAGG + Exonic
1066676731 10:37895818-37895840 CCCACATTCATTACATTCATAGG - Intergenic
1066682884 10:37952286-37952308 CCCACATTCCTTGCATGCATAGG + Exonic
1066693440 10:38056199-38056221 CCCACATTCATTGCATTCATAGG - Exonic
1066999367 10:42592853-42592875 CCCACATTCATTGCATTCATAGG + Exonic
1067122126 10:43482409-43482431 CCCACATTCAGTGCATTCATAGG - Exonic
1067122168 10:43482911-43482933 CCCACATTCACTACATGCATAGG - Exonic
1067126823 10:43524787-43524809 CCCACATTCATTACATTCATAGG - Intergenic
1067508315 10:46874992-46875014 GACAAATTCATTGCAGGCTTAGG - Intergenic
1067653935 10:48176857-48176879 GACAAATTCATTGCAGGCTTAGG + Intronic
1074423843 10:113333478-113333500 CCCACATTCCTTGCTGGGGATGG - Intergenic
1076415347 10:130283238-130283260 TCCACACTCATTGCATTCGTAGG + Intergenic
1076415359 10:130283326-130283348 CCCACATTCTTTACACGCATAGG + Intergenic
1080942063 11:36930053-36930075 ACCACAGTCATTTCAGGCCTAGG + Intergenic
1083755130 11:64788235-64788257 CCTACATTCAAGGCAGGTGTTGG - Intergenic
1083758845 11:64805080-64805102 CCCACATGCAGCACAGGCGTGGG + Exonic
1088831235 11:113538774-113538796 CCCACATTCATTGCAGGGAGAGG - Intergenic
1088896265 11:114080899-114080921 TCCACCTGCTTTGCAGGCGTGGG + Intronic
1091953594 12:4616358-4616380 CCAAAATTCATTGCAGGTATTGG + Intronic
1096557256 12:52411024-52411046 CTCTCATTCATTGCAGCCCTGGG + Intergenic
1097277400 12:57822739-57822761 CCGACATTCATTACAGGCCCAGG + Exonic
1104093517 12:125535813-125535835 CCCACACTCTTTGCAGGAGAGGG + Intronic
1105036338 12:132925682-132925704 CCCACATTCACTGCATTCATAGG + Exonic
1105036387 12:132926186-132926208 ACCACATTCGTTGCATTCGTAGG + Exonic
1105046788 12:133010649-133010671 CCCACATTCACTGCAGCCATAGG - Exonic
1105046832 12:133011069-133011091 CCCACATTCACTGCATCCATAGG - Exonic
1105051608 12:133057668-133057690 CCCACATTCATTGCATCCATAGG - Exonic
1105051665 12:133058340-133058362 CCCACATTCACTGCATTCATAGG - Exonic
1105061565 12:133156457-133156479 TCCACATTCATTGCATTCATAGG - Exonic
1105066354 12:133202594-133202616 CCCACATTCATTACAACCATAGG - Intergenic
1105066413 12:133203350-133203372 CCCACATTCATGGCATTCATAGG - Intergenic
1105066464 12:133203938-133203960 CCCACATTCACTGCATTCATAGG - Intergenic
1105066503 12:133204358-133204380 CCCACATTCATTGCACCCATAGG - Intergenic
1114782004 14:25548354-25548376 CCCAAATTCTTTGCAGTCTTCGG + Intergenic
1120529219 14:85611689-85611711 CCCACTGTCATTTCAAGCGTAGG + Intronic
1121340739 14:93103700-93103722 CCCAGATTCATTCCAGGGGAGGG + Intronic
1122938306 14:104970060-104970082 CCCACATTCAGGGCAGCCGCAGG - Intronic
1202888680 14_KI270722v1_random:134235-134257 TCCACATTCATTGCATCCATAGG - Intergenic
1202888716 14_KI270722v1_random:134651-134673 CCCACATTCATTGCATTCATAGG - Intergenic
1202888726 14_KI270722v1_random:134735-134757 CCCACGTTCATTGCATTCGTAGG - Intergenic
1125422053 15:39513662-39513684 TCCACATCCAGTGAAGGCGTTGG - Intergenic
1125957148 15:43798391-43798413 CCCACACTCTTGGCAGGAGTAGG - Exonic
1127661872 15:61107062-61107084 GCTACATTCATTGCTGGAGTGGG + Intronic
1129832854 15:78681947-78681969 CCCTGATTCATGGCAGGCCTTGG + Intronic
1132678905 16:1131703-1131725 CCCACCTTCCTTCCAGGCCTAGG + Intergenic
1133051483 16:3119664-3119686 CCCGCAGTCAGTGCAGGCGTAGG - Exonic
1137965543 16:52929006-52929028 CCCACATACATTGCTGGGGAAGG - Intergenic
1139681153 16:68564526-68564548 CCCACATTCATTACATTCATAGG - Exonic
1142436027 16:90058005-90058027 CCCACACTCTCTGCAGACGTAGG + Exonic
1143198135 17:5092511-5092533 CCCACATTCATTACATTCATAGG - Exonic
1143199990 17:5106064-5106086 CCCACATTCATTACATTCGAAGG + Exonic
1143557042 17:7668312-7668334 CCCACACTCATTGCAGACTCAGG + Intronic
1144491550 17:15716533-15716555 CCCACATTCATTGCAGGTATAGG - Exonic
1144491579 17:15717034-15717056 CCCACATTCATTACACTCATAGG - Exonic
1144601812 17:16622528-16622550 TCCACATTCCTTACAGGTGTAGG + Exonic
1144601882 17:16623368-16623390 CCCACATTCATTACATTCATAGG + Exonic
1144908934 17:18662672-18662694 CCCACATTCATTGCAGGTATAGG + Exonic
1144913962 17:18706758-18706780 CCCACAGTCTTTACAGGTGTAGG + Intronic
1145960449 17:28883925-28883947 CCCCCATTCTTTGCAGGTGTTGG - Intronic
1149047759 17:52267386-52267408 CCTACATTTAATGCAGGCGGGGG + Intergenic
1158610294 18:58934515-58934537 CCCACACTCAGGGCAGGTGTAGG - Exonic
1158860284 18:61584808-61584830 CCCAGAGTCAGTGCAGGCTTTGG - Intergenic
1158960529 18:62584301-62584323 CCCGCATTCTCTGCAGGCGGAGG - Intronic
1161174728 19:2834539-2834561 TCCACATTCACTGCATTCGTAGG - Exonic
1161177348 19:2853081-2853103 CCCACATTGTTTGCATTCGTAGG - Exonic
1161182898 19:2897185-2897207 CCCACATTCTTTGCATTTGTAGG + Intergenic
1161187763 19:2933633-2933655 CCCACATTCAGTACATTCGTAGG + Exonic
1161896208 19:7082987-7083009 CCCACATTCACTGCAGCCATAGG - Exonic
1161896218 19:7083071-7083093 CCCACAGTCATTGCATTCATAGG - Exonic
1161896228 19:7083155-7083177 CCCACAGTCACTGCATTCGTAGG - Exonic
1161896264 19:7083491-7083513 CCCACACTCATTACATGTGTAGG - Exonic
1162060908 19:8094632-8094654 CACACAGTGATTGCAGGTGTTGG - Intronic
1162243752 19:9381347-9381369 CCCACATTCCTTACAGTCATAGG - Exonic
1162619783 19:11832884-11832906 CCCACATTCCTTACATGCATAGG - Exonic
1162669905 19:12247925-12247947 CCCACATTCCTTGCATTTGTAGG + Intronic
1162715393 19:12628257-12628279 CCCACATTCCTTACATGCATAGG - Exonic
1165276786 19:34760102-34760124 CCCACACTCATTGCACTCATAGG + Exonic
1165297999 19:34944078-34944100 CCCGCATTCCTTGCATCCGTAGG - Exonic
1165299338 19:34958655-34958677 CCCACATTCACTGCACTCATGGG + Exonic
1165500159 19:36182691-36182713 CCCACATTCCTTACATTCGTAGG + Exonic
1165506772 19:36237156-36237178 CCCACATTCATTACAACCATAGG - Exonic
1165524322 19:36340704-36340726 CCCACATTCCTTACATTCGTAGG + Exonic
1165543603 19:36514141-36514163 CCCACATTCATTACAACCATAGG + Exonic
1165555430 19:36627201-36627223 CCCACATTCATTGCAAATATAGG - Exonic
1165565216 19:36720319-36720341 CCCACATTCATTACAAACATAGG - Exonic
1165608373 19:37127572-37127594 CCCACATTCCTTACATGCATAGG - Exonic
1165614365 19:37186121-37186143 CCCACATTTATTGCATACATAGG + Exonic
1165643610 19:37412906-37412928 CCCACATTCATTACATACATAGG + Exonic
1165643630 19:37413158-37413180 ACCACATTCATTGCATTCATAGG + Exonic
1165656512 19:37537335-37537357 CCCACACTCACTACAGACGTGGG - Exonic
1165656558 19:37537755-37537777 CCCACATTCATTGCACCCATAGG - Exonic
1165664213 19:37612677-37612699 CCCACATTCCTTACATTCGTAGG - Exonic
1165664235 19:37612929-37612951 CCCACATTCTTTACAGTCATAGG - Exonic
1165670015 19:37669109-37669131 CCCACATTCATTACATTCATAGG + Exonic
1166019597 19:40014169-40014191 CCCACATTCCTTACACTCGTAGG - Exonic
1166019674 19:40015093-40015115 CCCACATTCATTACATATGTAGG - Exonic
1166019696 19:40015345-40015367 CCCACATTCATTACATATGTAGG - Exonic
1166331474 19:42080339-42080361 CCCACATTCCTGGCAGCGGTAGG - Exonic
1166576730 19:43847806-43847828 CCCACATTCCTTGCATTCATAGG - Exonic
1166628832 19:44387195-44387217 CCCACATTCATCGCATTTGTAGG + Exonic
1166652913 19:44588294-44588316 ACCACATTCACTGCATGCATAGG - Intergenic
1166684775 19:44789867-44789889 CCCAAATCCATTGCTGGCCTGGG - Intronic
1167536832 19:50059025-50059047 CCCACATTCCTTGCAGGCGTAGG + Intergenic
1167536897 19:50059445-50059467 CCCACATTCGTTGCATACATAGG + Intergenic
1167536997 19:50060033-50060055 GCCACATGCATGGCAGGCATAGG + Intergenic
1167779375 19:51588088-51588110 CCCACATTCAGTGCACACATAGG - Exonic
1167813960 19:51862290-51862312 CCCACATTCACTGCATTCATGGG + Intronic
1167819594 19:51914895-51914917 CCCACATTCACTGCATCCATAGG + Intronic
1167819626 19:51915231-51915253 CCCACATTCGTTGCATCCATAGG + Intronic
1167822864 19:51945163-51945185 CCCACATTCATTGCATACATAGG - Exonic
1167828215 19:51994446-51994468 CCCACATTCACTGCATACATGGG + Exonic
1167830428 19:52016215-52016237 ACCACATTCATTGCATTCATAGG + Exonic
1167830478 19:52016965-52016987 CTCACATTCAATGCATGCATGGG + Exonic
1167832254 19:52034290-52034312 CCCACATTCACTGCATGTGTAGG + Exonic
1167832278 19:52034626-52034648 CCCACATTCACTACAGATGTAGG + Exonic
1167832292 19:52034794-52034816 TCCACATTCATTGCATATGTAGG + Exonic
1168442716 19:56384466-56384488 CCCACATTCCTTGCATGCATAGG + Exonic
1168448193 19:56441312-56441334 CCCACATTCATTACATTCATAGG + Exonic
1168541238 19:57212206-57212228 CCCACATTCACTGCACTCATAGG - Exonic
1168546388 19:57253928-57253950 CCCACATTCACTGCACTCATAGG - Exonic
1168580017 19:57547533-57547555 CCCACATGCATTGCATTCATAGG + Exonic
1168598840 19:57701776-57701798 CCCACATTCACTGCACTCATAGG + Exonic
1168618745 19:57859632-57859654 CCCACATTCCTTGCACTCATAGG - Exonic
1168624764 19:57909036-57909058 CCCACATTCCTTGCACTCATAGG + Exonic
1168633889 19:57979462-57979484 CCCACATTCATTGTAGTCATAGG + Exonic
1168647218 19:58067458-58067480 CCCACACTCACTGCACTCGTAGG - Exonic
1168673907 19:58262908-58262930 CCCACAATCAATGCATTCGTAGG - Exonic
1168698076 19:58417156-58417178 CCCACATTCATTACACACATGGG - Exonic
1202664082 1_KI270708v1_random:101029-101051 TCCACATTCATTGCATCCATAGG - Intergenic
1202664118 1_KI270708v1_random:101445-101467 CCCACATTCATTGCATTCATAGG - Intergenic
1202664127 1_KI270708v1_random:101529-101551 CCCACGTTCGTTGCATTCGTAGG - Intergenic
927371603 2:22362263-22362285 TCAACATTCATTGTAGGCTTGGG + Intergenic
932564779 2:72898987-72899009 CCTAAATTCATTCCAGGAGTGGG + Intergenic
933338765 2:80995151-80995173 CCCACATTCATGGGAGGCTAAGG + Intergenic
933646940 2:84820745-84820767 ACCACCTGTATTGCAGGCGTAGG - Intergenic
934537711 2:95149687-95149709 CCCACATTCACTGCATTCATAGG + Exonic
934545805 2:95214945-95214967 CCCGCATTCATTGCATTCATAGG - Exonic
935651545 2:105386385-105386407 CCCACACTCCTCGCAGGTGTTGG + Exonic
935748155 2:106207500-106207522 TCCACATTGATTACAGGCATGGG - Intergenic
938975190 2:136470169-136470191 CCCACATTTCTTGGAGGCTTTGG - Intergenic
947838720 2:233193796-233193818 CCCACTTTCCCTGCAGGCGAGGG + Exonic
1170658760 20:18315993-18316015 CCCACACTCCTTGCAGGCGTAGG - Exonic
1173885644 20:46456547-46456569 TCCACATTTATTGCAGTCATAGG + Intergenic
1173890167 20:46501605-46501627 CCCACATTCATTACACTCATAGG + Exonic
1175992120 20:62794718-62794740 CCCACAATTACTGCAGGCATAGG - Intergenic
1176840575 21:13839290-13839312 CCCACATTCCTTGCATTCATAGG - Intergenic
1178088231 21:29134435-29134457 CACACAACCATTGCAGGCTTGGG + Intronic
1178789385 21:35685378-35685400 CCCACATTCACTTCAGACTTTGG + Intronic
1180175090 21:46083412-46083434 CCCACAGTCGTCGCAGGGGTGGG - Intergenic
1180330809 22:11477913-11477935 TCCACATTCATTGCATCCATAGG - Intergenic
1180330845 22:11478329-11478351 CCCACATTCATTGCATTCATAGG - Intergenic
1180330854 22:11478413-11478435 CCCACGTTCATTGCATTCGTAGG - Intergenic
1181235692 22:21446574-21446596 GCCACACTCATCGCAGGCGAAGG - Exonic
1181520384 22:23445769-23445791 CCCTCATTCATGGAAGGAGTAGG + Intergenic
1183371856 22:37437246-37437268 CCCACATTCATTGGAGTTTTAGG + Intergenic
1183386895 22:37519824-37519846 CCCACATGCACTGCGGGCGCGGG + Intergenic
1185353325 22:50349856-50349878 CCCAAACTGATTACAGGCGTGGG - Intronic
951323810 3:21278667-21278689 CCCACAGTCATGGAAGGCTTTGG - Intergenic
953168581 3:40487202-40487224 CCCACATTCTTTGCATGTGTAGG - Exonic
953628896 3:44594507-44594529 CCCACATTCACTGCATGTATAGG - Exonic
953633670 3:44643076-44643098 CCCACATTCATTACATTCATAGG - Exonic
953643837 3:44734987-44735009 ACCACATTCAGTGCATGTGTAGG - Exonic
957091818 3:75738084-75738106 CCCACATTCATTGCATTCGTAGG + Intronic
957091829 3:75738168-75738190 CCCACATTCATTGCATTCATAGG + Intronic
957091871 3:75738588-75738610 ACCACATTCATTGCATCCATAGG + Intronic
958044870 3:88271228-88271250 ACCACATCCATTGCAGACTTTGG + Intergenic
960149482 3:114236406-114236428 CCCACATTCTTTGCACTCGTAGG + Exonic
960149545 3:114236910-114236932 CCCACATTCCTTGCATTTGTAGG + Exonic
960735299 3:120772865-120772887 CCCCCACTCACTGCAGGCCTTGG + Intronic
965851194 3:173027620-173027642 CACATATTCAATGCAGGGGTTGG - Intronic
966022493 3:175232634-175232656 CCCACATTCAGAGCTGTCGTGGG + Intronic
974556300 4:63453142-63453164 CTCACAATCAATGCAGGAGTGGG + Intergenic
980324165 4:131319959-131319981 CCCACATTTCTTGAAGGCTTTGG + Intergenic
982000442 4:151016376-151016398 CCCACATTCATTCTAGGCAGAGG + Intergenic
986682957 5:10250357-10250379 CCCATATTCATCGAAGGCGAGGG - Exonic
987865181 5:23527664-23527686 CCCACACTCCCTGCAGACGTAGG - Exonic
991030707 5:62079511-62079533 TCCACATTCATTCAAGGCGTTGG + Intergenic
992001209 5:72438198-72438220 CCTAGATTCATTGCAGCTGTGGG + Intergenic
1000168649 5:158679759-158679781 CCCTCATTCCCTGCTGGCGTTGG + Intergenic
1001280063 5:170380435-170380457 GCCAGATTCCTTGCAGGCCTCGG + Intronic
1002366091 5:178712630-178712652 CCCACATTCATTGCATCTATAGG + Exonic
1002387939 5:178883678-178883700 CCCACATTCATTGCATCTATAGG - Exonic
1002406109 5:179033228-179033250 CCCACATTCATTACATTTGTAGG - Exonic
1004716502 6:18221129-18221151 CCCCCATTCATTGAAGCCTTTGG + Intronic
1004886622 6:20057673-20057695 CCCACAGTCATTGCAGCAGCGGG + Intergenic
1005593842 6:27358366-27358388 CCCACATTCATTACATTCATAGG + Intergenic
1005598367 6:27401197-27401219 CCCACATTCACTGCACTCATAGG - Exonic
1005669333 6:28089292-28089314 CCCACATTCACTACACTCGTAGG - Exonic
1005675830 6:28153746-28153768 CCCACACTCATTGCATTTGTAGG - Exonic
1007090240 6:39179806-39179828 ACCACAATCTTTGCAGGAGTAGG + Intergenic
1011488167 6:87864587-87864609 CCCACACTCATGGCAGCCGGGGG + Intergenic
1019073085 6:169365999-169366021 CCCACAGTCATCACAGCCGTGGG + Intergenic
1020048690 7:5064985-5065007 CCCACATTCATTACATTCATAGG - Exonic
1020048729 7:5065405-5065427 CCCACATTCATTACATTCATAGG - Exonic
1020285333 7:6674972-6674994 CACACATTCATTACACGCATAGG - Intergenic
1020285409 7:6675666-6675688 CCCACATTCATTACATACATGGG - Intergenic
1020287024 7:6691109-6691131 CCCACATTCATAACATTCGTAGG + Exonic
1020287096 7:6691949-6691971 CCCACATTCATTACATTCATAGG + Exonic
1020287115 7:6692117-6692139 CCCACATTCACTGCATTCATAGG + Exonic
1021094955 7:16525945-16525967 CCCACCTTCATCCCAGGTGTGGG + Intronic
1025756462 7:64348798-64348820 TCCACATTCATTACATGTGTAGG - Exonic
1025817422 7:64928362-64928384 ACCACATTCATTGCATTTGTAGG - Exonic
1026301645 7:69102981-69103003 TCCACACACATTGCAGCCGTAGG + Intergenic
1029238303 7:99142268-99142290 CCCACACTCACTGGAGGCTTTGG - Intronic
1029289851 7:99494039-99494061 CCCACATTCTTGGCAGCCATAGG + Exonic
1029294181 7:99526326-99526348 CCCACACTCATTGCAGCCATAGG - Exonic
1029358582 7:100071446-100071468 CCCACATTCATTACATTCATAGG + Exonic
1029358595 7:100071530-100071552 CCCACATTCATTGCAGGCGTAGG + Exonic
1033578456 7:142709669-142709691 CCCACATTCCTTGCAGGCTCAGG - Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1035440618 7:158894799-158894821 CTCACATTCATTGCTGGGGAAGG - Intronic
1045918441 8:107501551-107501573 GCCACATTCATTGCATTTGTTGG + Intergenic
1046543175 8:115612897-115612919 CCTACATTCAGTGCAGGAATGGG - Intronic
1048788695 8:138079894-138079916 CCCCCATTCATTGCCAGGGTGGG - Intergenic
1049377852 8:142297524-142297546 CCCACATTCACTGGGGGCTTTGG - Intronic
1049630287 8:143650657-143650679 CCCACATTCATTGCACTCATAGG - Exonic
1049852743 8:144842189-144842211 CCCACACTCCTTGCAAGGGTAGG - Exonic
1049858650 8:144881911-144881933 CCCACATTCGTAGCATGCATAGG + Exonic
1049865248 8:144931218-144931240 CCCACACTCGTGGCAGGCGTAGG + Exonic
1049865324 8:144931806-144931828 CCCACATTCATTGCATTCATAGG + Exonic
1049871035 8:144976677-144976699 CCCACATTCACTGCACTCATAGG + Intergenic
1053584715 9:39444930-39444952 CCCACATTCACTGCATTCATAGG + Intergenic
1053584734 9:39445098-39445120 CCCACATTCATTACACTCATAGG + Intergenic
1053584799 9:39445686-39445708 CCCACATTCATTACATTCATAGG + Intergenic
1054106295 9:61003676-61003698 CCCACATTCACTGCATTCATAGG + Intergenic
1054106314 9:61003844-61003866 CCCACATTCATTACACTCATAGG + Intergenic
1054581518 9:66919536-66919558 CCCACATTCATTACATTCATAGG - Exonic
1054581584 9:66920124-66920146 CCCACATTCATTACACTCATAGG - Exonic
1054581603 9:66920292-66920314 CCCACATTCACTGCATTCATAGG - Exonic
1054581612 9:66920376-66920398 CCCACATACATTACATTCGTAGG - Exonic
1056112051 9:83405804-83405826 CCCACCCTCACTGCAGGCATGGG - Intronic
1057633224 9:96738018-96738040 CCCACATTCATTACATTCATAGG - Intergenic
1059263022 9:112997279-112997301 CCCACATTCATTACACTGGTAGG + Intergenic
1059263073 9:112997867-112997889 CCCACATTCATTACAAGGATAGG + Intergenic
1059266932 9:113042797-113042819 CCCACATTCATTACATTCATAGG + Exonic
1060924199 9:127444359-127444381 CCCACATTCACTGCACTCATAGG - Exonic
1203485881 Un_GL000224v1:54158-54180 TCCACATTCATTGCATCCATAGG - Intergenic
1188272747 X:28160895-28160917 CCCACATTCATTGTTGGACTAGG + Intergenic
1190088073 X:47413311-47413333 CCCACATTCACTACATTCGTAGG - Exonic
1190134009 X:47777786-47777808 CCCACATTTAGTGCATGCATAGG + Intergenic
1190148013 X:47915716-47915738 CCCACATTCATTGCATTTATAGG - Exonic