ID: 1029362949

View in Genome Browser
Species Human (GRCh38)
Location 7:100100574-100100596
Sequence CGGGATTCCTCCGCCCAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029362945_1029362949 -6 Left 1029362945 7:100100557-100100579 CCAGCCGCTTCACAGCTCGGGAT 0: 1
1: 0
2: 1
3: 3
4: 55
Right 1029362949 7:100100574-100100596 CGGGATTCCTCCGCCCAGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 84
1029362942_1029362949 1 Left 1029362942 7:100100550-100100572 CCGGATTCCAGCCGCTTCACAGC 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1029362949 7:100100574-100100596 CGGGATTCCTCCGCCCAGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 84
1029362941_1029362949 2 Left 1029362941 7:100100549-100100571 CCCGGATTCCAGCCGCTTCACAG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1029362949 7:100100574-100100596 CGGGATTCCTCCGCCCAGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 84
1029362946_1029362949 -10 Left 1029362946 7:100100561-100100583 CCGCTTCACAGCTCGGGATTCCT 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1029362949 7:100100574-100100596 CGGGATTCCTCCGCCCAGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029362949 Original CRISPR CGGGATTCCTCCGCCCAGGG CGG Intronic
900950967 1:5858190-5858212 AGGGCTCCTTCCGCCCAGGGTGG - Intergenic
901416180 1:9118417-9118439 CGGGCTTCCTCCGTCCAGGCAGG - Intronic
902218979 1:14952739-14952761 CGGGCTTCCCCAGCCCAGGAAGG - Intronic
902773654 1:18660720-18660742 CAGGATTCCTGAGCCCAAGGAGG - Intronic
907213584 1:52843275-52843297 CAGGATTCCTCGCCCCAGTGCGG + Intronic
916656002 1:166876005-166876027 CGGGGTTTCTCCGGCCGGGGCGG - Intronic
917141550 1:171841057-171841079 CGCGATGACTCCTCCCAGGGTGG - Intergenic
920291693 1:204927983-204928005 CGGAATTCCTCCCCAGAGGGGGG + Intronic
923018546 1:230145557-230145579 GGGGATTCCTCCGCTGAGGTCGG + Intronic
923299638 1:232629802-232629824 CGGGATGCCTGCGGCCAGGCGGG - Intergenic
1063167086 10:3473454-3473476 AGGGATGCCCACGCCCAGGGTGG - Intergenic
1063664178 10:8051770-8051792 CGGGCTTCCTCCTCCCTTGGCGG - Intergenic
1066539010 10:36423950-36423972 CGGGATTCCACTGCCCAAGTAGG - Intergenic
1074433001 10:113409353-113409375 CGGGAAGCCTCCGCACAGTGTGG - Intergenic
1074905295 10:117857286-117857308 CTGCAATCCTCAGCCCAGGGAGG + Intergenic
1075438188 10:122460488-122460510 CTGGGTGCCTCTGCCCAGGGTGG + Intergenic
1076707224 10:132308407-132308429 CGGGCTTCCGCCGCCCAGTGCGG + Intronic
1077152181 11:1077363-1077385 CGGGACCCCGCCGCCCAGAGGGG - Intergenic
1080503801 11:32893234-32893256 CGGGGTTCGTACGCCCAGGCTGG - Exonic
1081549061 11:44095769-44095791 CGGGCCACCTCCGCCCAGGTCGG - Intronic
1083334249 11:61913540-61913562 CTGGATTCCCCCGCCAGGGGTGG - Intronic
1085312346 11:75524167-75524189 CAGGATACCTCTGCCCAGGAAGG - Intronic
1091194291 11:133718333-133718355 TGGGAATCCTCCTCCCAGGCCGG - Intergenic
1091238503 11:134037175-134037197 CGGGTCTCCTCCGAGCAGGGCGG + Intergenic
1094078585 12:26506494-26506516 CAGGATTCCTACTCCCAGGCTGG - Intronic
1096156878 12:49345954-49345976 TTGGATTCCTCCGCCCACGCGGG + Intergenic
1107481499 13:40789528-40789550 CGGGATGCCTGCGCGAAGGGAGG + Exonic
1114301606 14:21383988-21384010 CGGGATTCCTGGGCCGAGAGCGG - Exonic
1123040563 14:105488567-105488589 GGGGATGCCCCCTCCCAGGGAGG + Intronic
1124345366 15:28918487-28918509 CGGGATTCCTCCTTGCAGTGGGG - Intronic
1125980082 15:43992738-43992760 GGGTATTCCTCTGCCCAGGCTGG + Intronic
1134018351 16:10904823-10904845 CGGGATCTCTCTGCCCTGGGTGG + Intronic
1135295817 16:21278367-21278389 CGGGGTTGCTCCGCCCCCGGAGG - Intronic
1136641520 16:31569333-31569355 CGGGTTTCCTGCGACGAGGGCGG + Intergenic
1138144339 16:54595433-54595455 AGGGATTCCTGCCCCCTGGGAGG + Intergenic
1143078876 17:4366727-4366749 CGGGGTTCCGCCGCCGGGGGCGG - Intergenic
1143779267 17:9220936-9220958 AGGGATTCGTCAGGCCAGGGAGG + Intronic
1150285971 17:63954370-63954392 CTGGATGCCTCCCCCCAGAGAGG - Intronic
1151154820 17:72117106-72117128 CGGGATTCCACAGCCCTGAGTGG + Intergenic
1152356958 17:79812162-79812184 ATGGATTCCTCCGCCCAGGTGGG + Intergenic
1153985245 18:10345098-10345120 CTGGATTCCAGCGCTCAGGGTGG + Intergenic
1155566295 18:27138323-27138345 AGTGATTCCTCTGCCCATGGAGG + Intronic
1156036629 18:32772146-32772168 CGGGATCCCTCCGAGCCGGGCGG - Exonic
1157481337 18:48055885-48055907 CAGGTTTCCTCAGTCCAGGGTGG - Intronic
1161115823 19:2495864-2495886 GGGGATTCCTCCACTCAGGCTGG + Intergenic
1166539302 19:43595012-43595034 CGGGGTCCCTCGGGCCAGGGCGG + Exonic
926247658 2:11132898-11132920 CCGGAGTCCTCCGCACAGGGTGG - Intergenic
929055800 2:37875155-37875177 TGGGATTCCTCGGCACGGGGAGG + Intergenic
935215005 2:100968950-100968972 AGGGAGCCCTCCACCCAGGGCGG + Intronic
944329204 2:198445477-198445499 TGGGATACCCCAGCCCAGGGTGG + Intronic
948369025 2:237475591-237475613 CGTGACTCCTCCGCTCCGGGAGG - Intergenic
1169018153 20:2308627-2308649 GGGGAATCCTCAGCCCAGAGGGG - Intronic
1171372349 20:24669895-24669917 GGGTCTTCCCCCGCCCAGGGGGG - Intergenic
1176028311 20:62997682-62997704 CAGGCTTTCTCCCCCCAGGGAGG - Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1179146147 21:38769651-38769673 CAGGAGGCCTCTGCCCAGGGAGG + Intergenic
1183100999 22:35583988-35584010 CCGGATTCCACAGCCCAGTGGGG + Intergenic
953766382 3:45746744-45746766 CCGGATTCCTGCGCCTTGGGAGG + Intergenic
955324689 3:58000870-58000892 CAGGAGTCCTCACCCCAGGGCGG - Intergenic
964906779 3:161726822-161726844 GGGGTTTCTTCCCCCCAGGGAGG + Intergenic
968829075 4:2922831-2922853 CTAGATTCCTCCTCCCTGGGCGG - Intronic
972335969 4:38107244-38107266 CCGGCTGACTCCGCCCAGGGAGG + Intronic
979468911 4:121072265-121072287 CGGGATTCCCCAGCCCCGCGCGG - Exonic
997265114 5:132490813-132490835 CGGGATTCCCCAGCCCTGGCCGG + Intergenic
1001428305 5:171639542-171639564 CGTGATTTCTCAGCCCAGGACGG + Intergenic
1002424399 5:179166850-179166872 CGGGATTGCTCCGTGAAGGGAGG - Intronic
1006603602 6:35241740-35241762 CTGGATTCCTCCAGCCAGCGGGG + Intronic
1017663458 6:156696025-156696047 GGGGATTCCTGAGACCAGGGCGG - Intergenic
1020103360 7:5407813-5407835 CGAGACTCCACCTCCCAGGGTGG + Intronic
1022360223 7:29650017-29650039 CAGGTTCCCTCCGCCTAGGGTGG - Intergenic
1022903986 7:34838125-34838147 CAGCATGCCTCCCCCCAGGGAGG + Intronic
1024119758 7:46225031-46225053 TGGGATTCCACAGCCCAGTGTGG + Intergenic
1024304429 7:47915218-47915240 CAGGATTCCTTAGCCCAAGGAGG - Intronic
1029349147 7:100000684-100000706 CGGTATTCCTCAGGCCAGCGGGG - Intergenic
1029362949 7:100100574-100100596 CGGGATTCCTCCGCCCAGGGCGG + Intronic
1030723588 7:112898556-112898578 AGGGAATCCTCTGCCCTGGGGGG + Intronic
1031431548 7:121676755-121676777 CGGGATTACTACTGCCAGGGAGG - Intergenic
1035756361 8:2035947-2035969 GGGGGTTCCTCTGACCAGGGAGG - Intergenic
1040531151 8:48267401-48267423 CGGGAAGCCTCTGCCTAGGGAGG + Intergenic
1046793807 8:118348855-118348877 AGGGCTTCCTCGGCCCAGGTGGG - Intronic
1048985019 8:139730588-139730610 GGGGATTCCAAGGCCCAGGGAGG + Exonic
1048987561 8:139742922-139742944 CGGGTTTCCTCTGTCTAGGGTGG + Intronic
1049222268 8:141433534-141433556 AGGGCAGCCTCCGCCCAGGGTGG - Intergenic
1051806291 9:20996449-20996471 CTGGATGCCTAGGCCCAGGGAGG + Intergenic
1056824283 9:89865880-89865902 CTTTATTCCTCCTCCCAGGGTGG + Intergenic
1060107921 9:120885844-120885866 AGGTATTCCTCCACCCAGGCAGG - Intronic
1061859400 9:133460313-133460335 CGCCATTCCTCCGCCCCGGGAGG - Intronic
1062016165 9:134292429-134292451 CCGGATTCCTCCGGGCAAGGTGG + Intergenic
1189349665 X:40267163-40267185 CGGGCTTCCTCTGCGCCGGGCGG - Intergenic
1189726352 X:43970889-43970911 CGGGATTCTTCTACCCAGGCTGG + Intronic
1199990949 X:152987576-152987598 CAGGATTCCTCAGCCCAGGTGGG + Intergenic
1200034036 X:153317050-153317072 CAGGATTCCTCAGCCCAGGTGGG + Intergenic