ID: 1029364591

View in Genome Browser
Species Human (GRCh38)
Location 7:100108482-100108504
Sequence TAGGCGTCCTGATTGTCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029364579_1029364591 24 Left 1029364579 7:100108435-100108457 CCACCTGGGAGCAGAGGAGGGGC 0: 1
1: 1
2: 6
3: 58
4: 522
Right 1029364591 7:100108482-100108504 TAGGCGTCCTGATTGTCAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1029364587_1029364591 -8 Left 1029364587 7:100108467-100108489 CCGAATTCTGCCCGATAGGCGTC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1029364591 7:100108482-100108504 TAGGCGTCCTGATTGTCAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1029364583_1029364591 2 Left 1029364583 7:100108457-100108479 CCCAAGGGACCCGAATTCTGCCC 0: 1
1: 0
2: 3
3: 3
4: 112
Right 1029364591 7:100108482-100108504 TAGGCGTCCTGATTGTCAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1029364586_1029364591 -7 Left 1029364586 7:100108466-100108488 CCCGAATTCTGCCCGATAGGCGT 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1029364591 7:100108482-100108504 TAGGCGTCCTGATTGTCAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1029364584_1029364591 1 Left 1029364584 7:100108458-100108480 CCAAGGGACCCGAATTCTGCCCG 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1029364591 7:100108482-100108504 TAGGCGTCCTGATTGTCAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1029364574_1029364591 30 Left 1029364574 7:100108429-100108451 CCTTGACCACCTGGGAGCAGAGG 0: 1
1: 1
2: 1
3: 45
4: 471
Right 1029364591 7:100108482-100108504 TAGGCGTCCTGATTGTCAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1029364580_1029364591 21 Left 1029364580 7:100108438-100108460 CCTGGGAGCAGAGGAGGGGCCCA 0: 1
1: 1
2: 3
3: 57
4: 524
Right 1029364591 7:100108482-100108504 TAGGCGTCCTGATTGTCAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029364591 Original CRISPR TAGGCGTCCTGATTGTCAGG CGG Exonic
903280143 1:22245628-22245650 TAGGCCTCCTGACTTCCAGGTGG - Intergenic
903776553 1:25797753-25797775 GAGCCCTCCTGATAGTCAGGGGG + Intergenic
905257168 1:36692255-36692277 GTGGTGTCCTGATTCTCAGGAGG + Intergenic
913200589 1:116492865-116492887 TAGGCATACTGATCCTCAGGAGG - Intergenic
916229863 1:162531128-162531150 TAGGAGGCATGATTGACAGGTGG - Intergenic
924910802 1:248511322-248511344 TATGCCTCCTGATTCACAGGGGG - Intergenic
924913299 1:248536718-248536740 TATGCCTCCTGATTCACAGGGGG + Intergenic
1065767095 10:29040332-29040354 CAGGGGTCCAGATTGTCAGAAGG - Intergenic
1076717062 10:132371552-132371574 GAGGCTGCCTGCTTGTCAGGAGG + Intronic
1088759660 11:112917564-112917586 GAGGCTTCCTCTTTGTCAGGTGG - Intergenic
1091230194 11:133983325-133983347 TATGCGTCCTGATTGGGTGGTGG - Intergenic
1091771178 12:3152265-3152287 CAGCCCTCCTGATTGTCAGCAGG + Intronic
1109535734 13:63716822-63716844 TAGGCATCCTGTTTGTCTGCTGG + Intergenic
1109540367 13:63769464-63769486 TAGGCGTCCTGTTTGCCTGCTGG - Intergenic
1121610930 14:95278802-95278824 TAGGAGTCCTGTTTGTTAGTGGG - Intronic
1121941830 14:98078197-98078219 TGGTGGTCCTGATTGTCGGGAGG - Intergenic
1123716698 15:23039163-23039185 GACGCGTCCTGATCGTCACGGGG - Intronic
1125714121 15:41809670-41809692 TAGGCTTCCTGGCTGTCAGCAGG - Intronic
1129895836 15:79105217-79105239 TAGGCATCCTGATTTGCAGAGGG + Intergenic
1137395639 16:48114747-48114769 AAGGCGTCCTGATTGCCTGATGG - Intronic
1152309836 17:79543441-79543463 AGGGGGTCCTGCTTGTCAGGAGG - Intergenic
1152540209 17:80970939-80970961 GAGCCGTCCTGATGGGCAGGCGG + Intergenic
928384023 2:30848812-30848834 TGAGGGTCCTGATTGTTAGGAGG + Intergenic
948047531 2:234955154-234955176 TCGGATTCCTGGTTGTCAGGCGG - Intronic
1172976315 20:38908451-38908473 TAGGTCTCCTAATTGACAGGGGG + Intronic
953025003 3:39139707-39139729 TAGGCTTCCTGATTGTCCTGAGG - Intergenic
953281907 3:41566974-41566996 TAGGAGTCCTCACTGTCAGTGGG - Intronic
953424109 3:42778993-42779015 TAGGGCTCCTGATTGTGAAGTGG - Intronic
956533082 3:70243054-70243076 TAGGAGTTCTAATTGTAAGGTGG + Intergenic
962577446 3:136767816-136767838 TAGGGGTCCTCATTGTCAGGTGG - Intergenic
968445078 4:648344-648366 TAGGCATCCTGACTTGCAGGAGG + Intronic
986733317 5:10650315-10650337 TAGGTGTACTGATTGCTAGGAGG - Intergenic
987295625 5:16548274-16548296 TAGGCCTCCTGGTTATCAGCAGG + Intronic
995862813 5:116660227-116660249 CAGTCTTCCTGATTGTCAAGGGG + Intergenic
1003616250 6:7657808-7657830 TATTAATCCTGATTGTCAGGAGG - Intergenic
1007153258 6:39716704-39716726 TAGGTTTCCTGATTCTTAGGAGG + Intronic
1023388912 7:39688533-39688555 TTGGCTTCCTTATTGTCAAGAGG - Intronic
1029364591 7:100108482-100108504 TAGGCGTCCTGATTGTCAGGCGG + Exonic
1034195775 7:149246015-149246037 TTGGATTCCTGATTGTAAGGTGG + Intronic
1043403816 8:79910636-79910658 TAGGCTTCCAGCTTCTCAGGAGG - Intergenic
1044536307 8:93359930-93359952 AAGGCTTCCTGAGTGTCAGGGGG - Intergenic
1044601365 8:94008831-94008853 TGGGGGTCCTGATTGTTAGAAGG - Intergenic
1046526683 8:115389825-115389847 TGGGAGTCCTGATTGCCAGATGG + Intergenic
1053737016 9:41108373-41108395 TAGGTGTCCTAATAGCCAGGGGG - Intergenic
1054691332 9:68322944-68322966 TAGGTGTCCTAATAGCCAGGGGG + Intergenic
1185618139 X:1435709-1435731 TAGGCGTCCTGCTTGTCCACCGG + Exonic
1192871728 X:75191187-75191209 TAAGGGTCCTGATTGTTAGAAGG - Intergenic
1195654535 X:107322630-107322652 TTGGCCTCCTGATTGGCAGGTGG + Intergenic
1198142621 X:133820070-133820092 TTGGCTTCCTCATTGTCAGTGGG - Intronic
1198581225 X:138066862-138066884 GAGGCCACCTGATTGTCAGCAGG + Intergenic
1200380156 X:155828644-155828666 TAAGTGTCTTGATTGTCAGAGGG - Intergenic