ID: 1029366416

View in Genome Browser
Species Human (GRCh38)
Location 7:100119351-100119373
Sequence CCCCGCCCCCTCGTGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029366411_1029366416 -1 Left 1029366411 7:100119329-100119351 CCGGCGCTCGGCGCCATCTTGGC 0: 1
1: 0
2: 1
3: 8
4: 72
Right 1029366416 7:100119351-100119373 CCCCGCCCCCTCGTGGGAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 197
1029366407_1029366416 15 Left 1029366407 7:100119313-100119335 CCGAGACGCTGCTCACCCGGCGC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1029366416 7:100119351-100119373 CCCCGCCCCCTCGTGGGAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 197
1029366409_1029366416 0 Left 1029366409 7:100119328-100119350 CCCGGCGCTCGGCGCCATCTTGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1029366416 7:100119351-100119373 CCCCGCCCCCTCGTGGGAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029366416 Original CRISPR CCCCGCCCCCTCGTGGGAGC AGG Intronic
900082622 1:869914-869936 GCGCGCCCCCTGGTGGCAGCCGG - Intergenic
900101989 1:965939-965961 CCCCGCCACATCGTGGGCTCTGG + Intergenic
900176872 1:1294931-1294953 CCCCGGCCCTGGGTGGGAGCTGG - Intronic
900365839 1:2311644-2311666 CCCTGCCCCCACGTGGCTGCTGG - Intergenic
900558888 1:3293903-3293925 CCCAGCACACTCGTGGGTGCCGG + Intronic
901200055 1:7461690-7461712 CCCTGCCTCCTTGTGGGAGGTGG + Intronic
901817583 1:11803619-11803641 CCCCGCCCCCTTGTGCTGGCTGG - Intronic
902331124 1:15731719-15731741 CCCAGACCTCTCCTGGGAGCTGG + Intronic
902612024 1:17603080-17603102 CCCCCACCCCTGATGGGAGCCGG - Intronic
902648855 1:17823373-17823395 TCCCGCTCCCGAGTGGGAGCAGG - Intronic
902856553 1:19210300-19210322 TTCCGCCCCCTCCTGGGAGGCGG - Intergenic
903060718 1:20666635-20666657 CCCGGCCCCCCTGTTGGAGCTGG - Intronic
905975936 1:42173499-42173521 CCCCGCCCCCTAGTGGCCACAGG + Intergenic
915458934 1:156058191-156058213 CCCCACCTGCTCTTGGGAGCTGG - Intronic
915461617 1:156073940-156073962 CCCCTCCCCCTCAGGGGAGCCGG - Exonic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
920180086 1:204127162-204127184 CCCAACTCCCTCGTGGGATCAGG - Exonic
920379226 1:205526237-205526259 GCCTGCACCCTTGTGGGAGCTGG + Intronic
924381558 1:243470215-243470237 CCCAGCCCCGTCGGGGCAGCTGG - Intronic
1062760088 10:11452-11474 GCGCGCCCCCTGGTGGCAGCCGG - Intergenic
1065020015 10:21495920-21495942 CCCCACCCCCTCCGGGGACCGGG - Exonic
1065966560 10:30775463-30775485 CCCTGCCCCCTCGTCTGGGCAGG - Intergenic
1067769927 10:49115597-49115619 CCCCGGCCCCGCGTGGCAGGCGG - Intergenic
1067843877 10:49703026-49703048 CCCCCTCCCCTTGAGGGAGCGGG - Intronic
1068309890 10:55263517-55263539 CCTCTCCCCCTCGTGGCTGCTGG - Intronic
1070770722 10:79080864-79080886 CCCAGACCCCTCTGGGGAGCTGG - Intronic
1071546791 10:86535651-86535673 CCCCGCCCCCACCTGTGACCTGG + Intergenic
1071603682 10:86970979-86971001 TCCCGGCCCCTCCTGGGAGCTGG + Intronic
1076402892 10:130195042-130195064 CCCCACTCCCTCCTGGGTGCAGG + Intergenic
1079128695 11:17735491-17735513 CCCCTCCCCCTCCTGGGGGCTGG + Exonic
1079210381 11:18455795-18455817 CCCCGCCCCCGCGTGCGGGTGGG - Intergenic
1081973326 11:47214918-47214940 CCCCGCCCCTTCCTGGAAGGCGG - Intronic
1083457104 11:62786684-62786706 CCGCGCCCCCTGGCGGCAGCGGG - Exonic
1083613659 11:64016052-64016074 CCCCGCCCCCTCCTTGGACTAGG + Intronic
1083765492 11:64839448-64839470 CCCCGCCCCAGAGTGGGAGCAGG - Intronic
1083823593 11:65186083-65186105 CCCCCACCCCTAGGGGGAGCTGG - Intronic
1084285618 11:68128664-68128686 CCCCGCCCCCCCTTGGGACCTGG + Intergenic
1084578989 11:70010720-70010742 CCAGGACCCCTGGTGGGAGCGGG - Intergenic
1084608871 11:70188078-70188100 CACCGGGCCCTGGTGGGAGCGGG - Exonic
1089543579 11:119206009-119206031 CCCCGCCCCGGCGTAGGGGCGGG + Intergenic
1093896719 12:24583147-24583169 CCCCGCCTCCACGTGAGAGCCGG - Intergenic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1096203804 12:49705684-49705706 CCCAGCCTCCTCGGGGGATCGGG - Intronic
1096465305 12:51845377-51845399 TCCTGCCCCCTTTTGGGAGCTGG - Intergenic
1103593686 12:122010089-122010111 CCCCATCCCCTCGCGGGTGCAGG - Intergenic
1104049141 12:125184838-125184860 CCCCATCCCCTCTTGGCAGCCGG + Intergenic
1104185285 12:126424812-126424834 CACGGCCACCTGGTGGGAGCTGG + Intergenic
1104856257 12:131903810-131903832 GCCCACTCCCTCCTGGGAGCTGG + Intronic
1104987138 12:132603602-132603624 CCAGGCGCCCTCGTGGGCGCTGG - Intronic
1105541714 13:21321600-21321622 CCCCACCCCCTCCTAGGGGCTGG - Intergenic
1106605418 13:31224080-31224102 CCCCGCCCCCGGGTGGAAGTGGG + Intronic
1108220977 13:48233161-48233183 CTCCGCCCTCGCGCGGGAGCTGG + Exonic
1110175728 13:72553599-72553621 TCCCTACCCCTCGTGGGAGGAGG + Intergenic
1114069879 14:19098119-19098141 CTCCACCCCCGCGTGGCAGCAGG + Intergenic
1120881233 14:89416826-89416848 CCCCGAGCCCACGCGGGAGCCGG + Intronic
1121145430 14:91578252-91578274 CCCCGCCCCATGGTGGGCTCCGG + Intergenic
1122388549 14:101365053-101365075 CCCCTCACCCTCGTGCAAGCCGG - Intergenic
1124158366 15:27248257-27248279 CCTCGCGCCCTCCTAGGAGCAGG + Intronic
1124591871 15:31060991-31061013 CCCTGCCCCCTCATGGCACCAGG + Intronic
1129351613 15:74958766-74958788 CCCCGTCTCCTGGTGGGATCAGG + Intronic
1129683067 15:77669190-77669212 CTCTGGCCCCTGGTGGGAGCAGG - Intronic
1129814528 15:78540329-78540351 CCCGTGCCCCTCGTGGGAGCTGG - Intergenic
1129814643 15:78540752-78540774 GCCCGCCCCCTCGCGGGCCCCGG - Intronic
1130535605 15:84783181-84783203 TCCCACCCCCTCTTGGGTGCGGG + Exonic
1130952744 15:88605290-88605312 CCCCACAGCCTCGCGGGAGCCGG + Intergenic
1131055343 15:89371542-89371564 CCCCGCGCCCTCGAGGCTGCGGG + Intergenic
1132639501 16:971145-971167 CCCCGCCCACGCGCGGGAGCGGG + Intronic
1132683414 16:1152921-1152943 CCCCGCCCCCCCCCGGGTGCGGG - Intergenic
1132873392 16:2125298-2125320 CCCCCACCCCTCGTGGGGCCAGG - Intronic
1134552479 16:15144477-15144499 CCCCCACCCCTCGTGGGGCCAGG - Intergenic
1135479829 16:22813716-22813738 CCCCACCCCCGCGTGGGTGTGGG + Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136246453 16:28979066-28979088 CCCTGCTGCCTCTTGGGAGCGGG + Intronic
1137583876 16:49652163-49652185 CCCCGCCCCCACATGGCTGCTGG + Intronic
1139591510 16:67935775-67935797 CCCCGCCCCTTCCTGTGGGCTGG + Intronic
1139949756 16:70663189-70663211 CCCCGCCTCCTGGAGGGAGAGGG + Exonic
1140096969 16:71883835-71883857 CCTCGCCCCCTCGCGGCCGCCGG - Intronic
1140412253 16:74748297-74748319 CCCACCCCCCACGTGGCAGCTGG + Intronic
1140473895 16:75229169-75229191 CACGGCACCCTCGTGGGACCAGG + Exonic
1141989451 16:87602153-87602175 CTCGGCCCCCTCCCGGGAGCTGG - Intronic
1142133521 16:88441573-88441595 CCCCTCCCCCAGGTGGGCGCTGG + Intergenic
1142174749 16:88639963-88639985 CCCCGAGCCGTCGCGGGAGCAGG - Exonic
1142637663 17:1268200-1268222 CCCCACCCCCTCCGGAGAGCGGG - Intergenic
1142890550 17:2940118-2940140 CCCCACCCCCTCCAGGCAGCAGG - Intronic
1143156989 17:4843884-4843906 ACCCACCGCCACGTGGGAGCAGG - Intronic
1143383460 17:6510513-6510535 CCCCACCCCCGTCTGGGAGCCGG + Intronic
1143495953 17:7312704-7312726 CCCCACCCCATCGTGGGTGAGGG - Exonic
1143595754 17:7912570-7912592 CCCCGGCCCCTCCTGGGAGGGGG - Exonic
1144834589 17:18150321-18150343 CCCCACCCTCTCGTGGGAGGGGG - Intronic
1145388979 17:22440523-22440545 CCCAGCCCTGTCCTGGGAGCAGG + Intergenic
1147793601 17:43027710-43027732 CCCCTCCCCCACCTGGGAACTGG - Intronic
1147879825 17:43646299-43646321 CCGCGCCCCCTCCTGGCAGCGGG + Intronic
1148867300 17:50635161-50635183 CCCCGACACCGCGTGGGACCCGG - Intronic
1149223291 17:54439884-54439906 CCCCCCCGACTCTTGGGAGCCGG + Intergenic
1151947417 17:77327261-77327283 CCTCAGCCCCTGGTGGGAGCAGG - Intronic
1152335486 17:79698240-79698262 CCCCGCCCCCACGCAGAAGCTGG + Intergenic
1152396289 17:80035709-80035731 CAGCGCCCCCTCGGCGGAGCTGG - Intronic
1152467356 17:80473861-80473883 CCCCGCCCCATCCTGGAATCAGG - Intronic
1152654949 17:81515015-81515037 CCCCGACCCCTCGGAGGCGCCGG - Intronic
1157322625 18:46646233-46646255 CCCCACCCCATCCTGGGATCTGG - Intronic
1157606934 18:48931872-48931894 CCCAGCCCCCTCCTGGGACTAGG + Intronic
1160763506 19:797339-797361 CCCCGCCCCCTGGCTGCAGCGGG + Exonic
1160851621 19:1195542-1195564 CCCAGCCCCCACCTGGGACCTGG + Intronic
1160851645 19:1195616-1195638 CCCAGCCCCCACCTGGGACCTGG + Intronic
1160852045 19:1197356-1197378 CCCAGCCCCCACCTGGGACCTGG + Intronic
1160852069 19:1197430-1197452 CCCAGCCCCCACCTGGGACCTGG + Intronic
1160992354 19:1864866-1864888 CCCCGCCGCCCCGCCGGAGCTGG - Intergenic
1161479244 19:4502465-4502487 CCCCCCAGCCTCGTGGGTGCGGG - Exonic
1161594107 19:5142495-5142517 CCCTTCCGCCTCGTGGTAGCAGG - Intronic
1161752934 19:6110566-6110588 CCCCGCCCCGTCGGGCGGGCGGG - Intronic
1161801340 19:6418133-6418155 CCCCACCTCCTCGGGGGTGCGGG + Intronic
1161978201 19:7617666-7617688 GCCCGCCCACACGTGGGAGTTGG + Intronic
1162312393 19:9914677-9914699 GCCCGCTCCCTCGGGGGAGCGGG + Intronic
1162312394 19:9914678-9914700 TCCCGCTCCCCCGAGGGAGCGGG - Intronic
1162741773 19:12777727-12777749 CCGCGCCCCCTGGTGGGCCCGGG - Intronic
1164155768 19:22596082-22596104 CCCCGCCCACTCTGGGGAGAGGG - Intergenic
1165491808 19:36127876-36127898 TGCCGCCCCCTCGTGGCAGATGG - Intergenic
1167070843 19:47221351-47221373 CCCCCCCTCCTCCTGGGAGGGGG - Exonic
1167292238 19:48630653-48630675 CCCCGCCCCCGCAAGGGAGGGGG + Exonic
1168257370 19:55174139-55174161 CCCCGCCCCCAAGCGGGACCAGG - Intronic
927102297 2:19797351-19797373 CCCAGCCATCTCGTGGGAGCTGG + Intergenic
929075604 2:38076780-38076802 CGCCGCCCGCTGGTGGGCGCGGG + Intronic
931449793 2:62359040-62359062 CCCCGCTGCCTCATGGGAGAGGG + Intergenic
931682925 2:64768019-64768041 CCCCTCTCCCTCCTAGGAGCTGG + Intergenic
932238939 2:70142368-70142390 GACCGCTCCCTCGTGCGAGCGGG - Intergenic
938496777 2:131801939-131801961 GCGCGCCCCCTGGTGGCAGCCGG + Intergenic
939723183 2:145680501-145680523 CACCGCCCCCTCGTGAAAACTGG + Intergenic
940259285 2:151763861-151763883 ACCCACCCCCTCATGGCAGCTGG - Intergenic
942044447 2:172091133-172091155 CCCCTACCCCGCGCGGGAGCTGG - Intergenic
942678372 2:178451311-178451333 CCCCGCTCCCGCGTGGGCACAGG + Intronic
946100491 2:217316187-217316209 CTCCAACCCCTTGTGGGAGCAGG - Intronic
947418652 2:229922275-229922297 CCCCTCCCCTCCGTGGTAGCAGG + Intronic
947501964 2:230677401-230677423 CCCAGCCTCCTCTTGGCAGCAGG - Intergenic
948379422 2:237542271-237542293 CTCCAGCCCCTCATGGGAGCCGG + Intronic
948421724 2:237864164-237864186 CCCCACCCCCTGGAGTGAGCTGG - Intronic
948466291 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG + Intergenic
948859393 2:240745585-240745607 CCCAGCGCCCTCGTGTGAGGTGG - Intronic
948871552 2:240801735-240801757 CCCCTCCACCACGTGAGAGCAGG + Intronic
948890893 2:240906611-240906633 CCCTGCACCCTCCTGAGAGCAGG + Intergenic
948897813 2:240935339-240935361 CCCCGACACCTGGTGGCAGCTGG + Intronic
1168786450 20:543817-543839 CCCCGCCTCCTGGTAGGAGGGGG - Exonic
1172765093 20:37346656-37346678 CCCCGGCCCCGGGTGGGAGGTGG + Intronic
1175199160 20:57266291-57266313 CCCCGCCCCCTGCTCGGTGCTGG + Exonic
1175401079 20:58700264-58700286 TCCCTCCCCCTCATGTGAGCAGG - Intronic
1176237323 20:64059640-64059662 CCCCAGCCCCTGGTGGGGGCGGG + Intronic
1176549279 21:8214461-8214483 GCCCGCCCCCTCCGGGGAGGAGG - Intergenic
1176557172 21:8258684-8258706 GCCCGCCCCCTCCGGGGAGGAGG - Intergenic
1176568211 21:8397499-8397521 GCCCGCCCCCTCCGGGGAGGAGG - Intergenic
1176576114 21:8441719-8441741 GCCCGCCCCCTCCGGGGAGGAGG - Intergenic
1178951537 21:36989974-36989996 CCCCGCCCCCTTCTGGCAGCTGG + Intronic
1179827589 21:43975645-43975667 CGTCGCCCCCTCCTGGGCGCTGG + Intronic
1179994562 21:44967993-44968015 CCCCGCCCCCTGCTGAGAGCTGG + Intronic
1180976336 22:19850875-19850897 AACGACCCCCTCGTGGGAGCAGG + Exonic
1181570909 22:23767508-23767530 CCCCGCCCCTTCGGGCCAGCCGG - Exonic
1183043556 22:35201758-35201780 CCCTGCCCCCCCGTGGGGGTAGG - Intergenic
1183702442 22:39457830-39457852 CCCCGCCCGGCCGTGGGAGGGGG - Intronic
1184566101 22:45293108-45293130 ACCCGCCGCCTCCTGGGAGAAGG + Intronic
1203254164 22_KI270733v1_random:130777-130799 GCCCGCCCCCTCCGGGGAGGAGG - Intergenic
1203262220 22_KI270733v1_random:175856-175878 GCCCGCCCCCTCCGGGGAGGAGG - Intergenic
952889041 3:38029165-38029187 CGCCGCCCCTCCGTGCGAGCGGG + Intronic
962891709 3:139677991-139678013 CCCCGCCCCTTCGCTGGGGCGGG + Exonic
967762451 3:193241187-193241209 CCCCGCCTCCTGGGCGGAGCGGG + Exonic
968546088 4:1199762-1199784 CCCCGGCCCCTCCTGCCAGCTGG - Intronic
968801738 4:2747392-2747414 CCCCGCTCCCAGGTGGGAGATGG - Intronic
969272308 4:6111146-6111168 CCCCGTCCCCACCTGGAAGCTGG + Intronic
969532964 4:7739850-7739872 CTCCGCCCCCTCCTGGCAGTGGG - Intronic
970425076 4:15938432-15938454 CCACGCCCCTCCGAGGGAGCCGG + Exonic
972390198 4:38606692-38606714 CTCAGACCCCTAGTGGGAGCAGG + Intergenic
985125836 4:186693552-186693574 CCCAGCCACCTCCTGGGAGCAGG + Intronic
985654591 5:1123327-1123349 CCCCCTCCCCTCCTCGGAGCCGG - Intergenic
986486748 5:8245598-8245620 CTCAGCCCCCTCCTGGTAGCTGG - Intergenic
989229987 5:39074474-39074496 CCCCGCCCCCTCGGCGGCGACGG + Intergenic
993905740 5:93621299-93621321 CCCCGCCCCCTCGCGGGCGCGGG + Intronic
998266830 5:140673106-140673128 ACCCGCCCCGTCGAGGGAGGGGG - Intronic
1002183331 5:177442535-177442557 CCCCACCCCCTCCTAGGGGCTGG - Exonic
1003058163 6:2841590-2841612 CCCCGCCCCCGCCTGGGTACAGG - Intronic
1006599171 6:35214324-35214346 CCCCTCCCCCTCCTGCGAGCTGG + Intergenic
1006639132 6:35480006-35480028 CCCAGCACCCTCCTGGGTGCAGG - Intronic
1018910049 6:168096592-168096614 CCTCTCCCCTTCCTGGGAGCCGG - Intergenic
1019225325 6:170503518-170503540 TCCCTTCCCCTAGTGGGAGCAGG - Intergenic
1020109356 7:5439580-5439602 CCCCGCCCCCGCCTGGCTGCCGG + Intronic
1020288838 7:6706812-6706834 CCCCGCGCCCGCTTGGGTGCCGG + Exonic
1021958774 7:25852511-25852533 CCCCGCCGCCTCGCCGGAGGCGG + Intergenic
1022427665 7:30284552-30284574 CCCCGCCCCCTCGTGCCGCCAGG - Exonic
1023909213 7:44541695-44541717 CCCTACCCCCTCTTGGGACCAGG + Intergenic
1024961614 7:54982099-54982121 CCCCTCCCCTTCGTGTGGGCTGG - Intergenic
1029366416 7:100119351-100119373 CCCCGCCCCCTCGTGGGAGCAGG + Intronic
1029449541 7:100633192-100633214 CCGCGCCCCATCCTAGGAGCGGG + Intronic
1029550063 7:101232790-101232812 CCCCCCGCCCTCGGGGCAGCGGG - Intronic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1033795023 7:144836102-144836124 CCCCGCCCGCTTCCGGGAGCCGG + Intronic
1035564816 8:634654-634676 CCCCCACCCATCGTGGGGGCTGG - Intronic
1037802269 8:22042331-22042353 CCCTGCCCCCTGGAGGGAGGCGG + Intergenic
1044306403 8:90645752-90645774 CCCCGCCCCCGCGGGGAAGGCGG + Exonic
1044734943 8:95269318-95269340 CCGCGAGCCCTCGTGGGCGCCGG - Intergenic
1047445033 8:124912152-124912174 CCCCACAACCTCCTGGGAGCAGG + Intergenic
1047615436 8:126558574-126558596 CCACGCCCCCGCGCCGGAGCGGG + Intergenic
1049436665 8:142589286-142589308 CCCCTTTCCCTCCTGGGAGCAGG - Intergenic
1049442254 8:142614780-142614802 CCACGCCCCCTCCCGGGCGCTGG + Intergenic
1049583063 8:143421464-143421486 CCCCGCCCGGCCGGGGGAGCAGG + Intronic
1049680553 8:143916116-143916138 CCCCGCGCCTCGGTGGGAGCCGG + Exonic
1055010943 9:71564398-71564420 CCCTGGCCTCTCTTGGGAGCTGG - Intergenic
1056835416 9:89951265-89951287 CCCTCCCCACTCCTGGGAGCTGG - Intergenic
1057145663 9:92757578-92757600 CCCCGCCCCCCCGCAGTAGCTGG - Intronic
1057921734 9:99104236-99104258 CCCCTCCGCCCCGCGGGAGCTGG + Intronic
1060990311 9:127845208-127845230 CCCTGCCCCCTCCTCTGAGCCGG - Intronic
1061038913 9:128128449-128128471 TCCCGCCCCCTCTCGGGCGCCGG - Exonic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1061994302 9:134176029-134176051 CCCTGCCTCCAGGTGGGAGCCGG - Intergenic
1062384966 9:136305568-136305590 CCCTGTCCCTTCATGGGAGCAGG - Intronic
1062733729 9:138122995-138123017 CCCCTTCCACTCGTGGGAGGAGG - Exonic
1203470565 Un_GL000220v1:113921-113943 GCCCGCCCCCTCCGGGGAGGAGG - Intergenic
1203478386 Un_GL000220v1:157893-157915 GCCCGCCCCCTCCGGGGAGGAGG - Intergenic
1189286837 X:39857818-39857840 CCCAGCCCACTCCTGGGTGCAGG - Intergenic
1198005498 X:132489414-132489436 CCCGGCCTCCGCGAGGGAGCTGG - Intronic
1200032361 X:153306914-153306936 CCCTGCCCCCTCATAGGAGCTGG + Intergenic
1200124480 X:153806837-153806859 CCCGGACCCCTCGTGGCAGGAGG - Exonic
1200402677 X:156028755-156028777 CACCGCCCCCTCGTGGCGCCGGG - Intergenic