ID: 1029366437

View in Genome Browser
Species Human (GRCh38)
Location 7:100119494-100119516
Sequence TTGCAGTAATTACACCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029366437_1029366439 -3 Left 1029366437 7:100119494-100119516 CCCTCTTGGTGTAATTACTGCAA 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1029366439 7:100119514-100119536 CAATTTATTCCTTCACTACCCGG 0: 1
1: 0
2: 1
3: 10
4: 137
1029366437_1029366444 17 Left 1029366437 7:100119494-100119516 CCCTCTTGGTGTAATTACTGCAA 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1029366444 7:100119534-100119556 CGGCTGCCAGGACCTTCAAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
1029366437_1029366440 5 Left 1029366437 7:100119494-100119516 CCCTCTTGGTGTAATTACTGCAA 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1029366440 7:100119522-100119544 TCCTTCACTACCCGGCTGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1029366437_1029366447 30 Left 1029366437 7:100119494-100119516 CCCTCTTGGTGTAATTACTGCAA 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1029366447 7:100119547-100119569 CTTCAAGAGGCGCCACAAAACGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029366437 Original CRISPR TTGCAGTAATTACACCAAGA GGG (reversed) Intronic
900584416 1:3425573-3425595 TCGCAGTACTTACACCTGGAAGG - Exonic
900743937 1:4347577-4347599 TTGGAGTACTTACTCTAAGAGGG + Intergenic
904921465 1:34011414-34011436 TTGCAGTGTTTCCATCAAGATGG + Intronic
907122946 1:52023602-52023624 TTGCAGTAATTACAACAGACAGG + Intronic
908022423 1:59911990-59912012 TAGAAGTAAATACACAAAGATGG - Intronic
909544474 1:76830171-76830193 TTGAAGTAATTAAAGCAAAAGGG + Intergenic
912190186 1:107329391-107329413 TTGCTGTAATTAGAACAAGGTGG + Intronic
914425800 1:147574606-147574628 TAGCAGTAATTATCCCAACATGG + Intronic
917438415 1:175044394-175044416 TCGCAGGAATTTCGCCAAGAAGG + Intergenic
919636177 1:200005827-200005849 TTGCATTACTTACTCCCAGAAGG + Intergenic
920540926 1:206777468-206777490 ATGGGGTAACTACACCAAGAAGG - Intergenic
921721166 1:218473164-218473186 TGGCAGTAATAACACCCTGATGG + Intergenic
924390010 1:243544321-243544343 TTGCAGTACTAAGAACAAGAAGG + Intronic
924567215 1:245208855-245208877 TTGCTGTAAACACACAAAGAAGG - Intronic
1063588790 10:7376793-7376815 TTGCAGTGATGCCCCCAAGAAGG - Intronic
1063913264 10:10853981-10854003 TTGCAGAAACTACACAAAGAAGG - Intergenic
1064566624 10:16646400-16646422 TTTCAGTCATTGAACCAAGAAGG - Intronic
1065586217 10:27219672-27219694 TTGCAATAAATAAACTAAGAGGG - Intronic
1068290280 10:54992991-54993013 TAGCAGAAACTCCACCAAGATGG + Intronic
1069026356 10:63546623-63546645 CTACAGTAATTACAACAACATGG + Intronic
1071361253 10:84848202-84848224 TTACTGTAACTATACCAAGAAGG - Intergenic
1072400887 10:95098618-95098640 TATTAGTAATTACACAAAGATGG + Intergenic
1075230060 10:120668664-120668686 ATCCAGTAATTACACAAATAAGG + Intergenic
1078118983 11:8487035-8487057 TTGTCTTAATTACACCAAAATGG + Intronic
1078918364 11:15802472-15802494 TTGCAGTAGCTCCACCAAGAGGG - Intergenic
1079292757 11:19203020-19203042 TTGCAGTAATTTCACAAAGACGG + Intronic
1079851066 11:25535387-25535409 TTGCAGTAATTAGCAAAAGATGG + Intergenic
1080452109 11:32386209-32386231 CTGCAGTAAATAAAGCAAGATGG + Intergenic
1082315791 11:50718949-50718971 TTGCAGATACTACAGCAAGAGGG + Intergenic
1085109515 11:73875256-73875278 TTGCAAAAATTTCACCATGATGG + Intronic
1085486050 11:76863759-76863781 TTACAGTAATTTCAAAAAGAAGG + Intronic
1087524869 11:99296930-99296952 ATGCAGATATTAAACCAAGAAGG + Intronic
1087551323 11:99653919-99653941 TGGCAGTATTTAGACAAAGAGGG - Intronic
1090499322 11:127246491-127246513 TTGCAGTAAGTACACACAGGAGG + Intergenic
1097521435 12:60675561-60675583 CTGCAGTAATTAAAACAACAGGG - Intergenic
1097909856 12:64958185-64958207 GTGCAGCAATTACACAAAGCAGG - Intergenic
1099592914 12:84618886-84618908 TTGATGTGATTATACCAAGAAGG + Intergenic
1100191093 12:92192563-92192585 TTGCAGTAAATAAATCAACAGGG + Intergenic
1103135331 12:118502209-118502231 TTGAAAAAATAACACCAAGAAGG - Intergenic
1105846028 13:24294728-24294750 TTGCTGTAATCACTGCAAGATGG - Exonic
1109239472 13:59867170-59867192 TTGAAGTAAATAAAACAAGATGG + Intronic
1110880746 13:80569328-80569350 TTGGAATAATGACCCCAAGAAGG - Intergenic
1114876259 14:26723138-26723160 TAGCAGTAATAACATCAAGTAGG + Intergenic
1126449044 15:48785489-48785511 TGACAGTAATGACAGCAAGAAGG + Intronic
1127920565 15:63491135-63491157 CTGGAGAAATCACACCAAGAAGG - Intergenic
1131604872 15:93891687-93891709 TTCTAGTAATTTCATCAAGAAGG - Intergenic
1131938903 15:97539116-97539138 TTGCAGGACCTACTCCAAGAAGG + Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134603428 16:15551289-15551311 TTGCAGTAAATACACAAGGAAGG - Intronic
1134768944 16:16787826-16787848 CTGCAATAATTACATCAAAAGGG - Intergenic
1135801536 16:25501633-25501655 TTTCAGTAATTCCAGGAAGAGGG + Intergenic
1137370981 16:47905622-47905644 TTGCAGTAATTCCATGAAGTAGG + Intergenic
1139683268 16:68581707-68581729 TTTCAGAAATAACAGCAAGAGGG - Intergenic
1140793186 16:78411748-78411770 TTGCAGTGACTACACCTAAAAGG + Intronic
1142783974 17:2205314-2205336 TTGCTGTAATCCCAGCAAGATGG - Intronic
1145118745 17:20236483-20236505 TTGCAGTTATAAAAGCAAGAAGG + Intronic
1147781950 17:42949695-42949717 CTGCAGCACTTACCCCAAGAAGG + Intergenic
1153849823 18:9083000-9083022 TTGTAGTAATAGCACCAAGCTGG + Intergenic
1153871999 18:9330403-9330425 TTGCAGTAATTCCCCTAACAAGG + Intergenic
1154234108 18:12587040-12587062 TTGCAGTAATTCTATCAAGTAGG + Intronic
1157942786 18:51947155-51947177 TTATCGTAATTACACCATGAGGG + Intergenic
1159826376 18:73216591-73216613 TTAAAATAATTACACAAAGAAGG - Intronic
1159830958 18:73278036-73278058 TTCCAGAAATTACACTAAAATGG - Intergenic
925073451 2:989781-989803 TTGCATTATTTCCACAAAGAAGG - Intronic
933674416 2:85041232-85041254 TTGCAGTAATTCTGCTAAGATGG - Intronic
936471169 2:112799769-112799791 TTGCAGTATTTAAAACCAGAGGG + Intergenic
937136130 2:119555086-119555108 TTGTAGGAATTTCCCCAAGAGGG - Intronic
938632521 2:133183220-133183242 TTTCAGAAAATACAACAAGAGGG + Intronic
938825959 2:135005515-135005537 TTGCAGGAGTTCGACCAAGATGG - Exonic
940705841 2:157104170-157104192 TTGCAGAAATTTCTCAAAGAGGG - Intergenic
941160812 2:162032054-162032076 TTGCATTAAGTACATCAGGAAGG - Intronic
941206838 2:162583862-162583884 TTGTAGTAATCACACCTATATGG + Intronic
945347440 2:208734699-208734721 CTGCAGTAAATACAACAACATGG - Intronic
946074719 2:217064303-217064325 TTACAGCAATTACTTCAAGAAGG - Intergenic
946600672 2:221356636-221356658 TTGAAGAACTTACACCAAAAGGG - Intergenic
947563092 2:231175249-231175271 TGGCAGCAATTACTCCCAGATGG + Intergenic
948097632 2:235349125-235349147 TTGCCATAATAACACCAAGGGGG - Intergenic
1176916515 21:14632240-14632262 TTGCAGGGATTACACCGAGAAGG - Intronic
1177931129 21:27285431-27285453 TTTCAGTAATTAAATCAAGGTGG - Intergenic
1180882626 22:19217157-19217179 TTGTAGTAACTACAACAAGGAGG + Intronic
949352850 3:3142777-3142799 TAGGAGAAATAACACCAAGATGG + Intronic
951116910 3:18874409-18874431 TAGCAGGAACTACACGAAGAAGG + Intergenic
954882886 3:53847365-53847387 TTGCAGCAACTACAGCAAAAGGG - Intronic
959178633 3:102950401-102950423 GTGCAGAAATTACACAAGGAAGG + Intergenic
959670888 3:108976181-108976203 TAGCATTAATTACACAGAGATGG + Intronic
960275694 3:115726844-115726866 TGGAAGTAATTACACCATGAGGG + Intergenic
960912113 3:122659959-122659981 TTGCAGTTATTTTACCAACAAGG - Intergenic
962549768 3:136478232-136478254 TCGCAGTATTGTCACCAAGATGG - Intronic
963242112 3:143016433-143016455 CTGCAGTCATTCAACCAAGATGG - Intronic
963949153 3:151179556-151179578 GTACTGTAATTACCCCAAGAAGG + Intronic
966684149 3:182675867-182675889 TTGCAGTAAAGTCACCAAGTAGG - Intergenic
970348828 4:15180584-15180606 CTGCATGAATTACACCAATAGGG - Intergenic
970794947 4:19900260-19900282 TGTCAGGCATTACACCAAGAAGG + Intergenic
970808585 4:20064533-20064555 TTGCAGTAATTACATGCAGAAGG - Intergenic
971009489 4:22417795-22417817 TAGCAGGAATTTCACCAAGCAGG + Intronic
971246252 4:24930972-24930994 CTGGAATAATTACACCAAGCAGG - Intronic
973304738 4:48633215-48633237 TTCCTGTAATTATATCAAGAAGG + Intronic
980437049 4:132790599-132790621 TTACAGTAATTAAAACAGGATGG + Intergenic
980603471 4:135058310-135058332 TTGCAGAAATGAGAACAAGAAGG - Intergenic
982332957 4:154202280-154202302 TTGCAGGTATCACACAAAGAAGG - Intergenic
985094137 4:186395536-186395558 TTTCAGTAATTAAAACAATATGG - Intergenic
988622000 5:32832547-32832569 TTACAGGAATTACACCAAATAGG + Intergenic
990024760 5:51172958-51172980 TTGTTGTAATTACCCCCAGATGG - Intergenic
991142773 5:63264767-63264789 TTGTAGTAATTACAACAATGTGG - Intergenic
991678934 5:69118703-69118725 TTGCAGTTATTGCTCTAAGAAGG + Intronic
991919118 5:71636802-71636824 TTGCAGTGGTTACACGAAAAAGG - Intronic
995753599 5:115478301-115478323 TTTCAGTAACCACACAAAGATGG - Intergenic
996758389 5:126960117-126960139 TTGCTGGATTTACTCCAAGATGG - Intronic
998618949 5:143773274-143773296 TTGCCATAATAACACCAAGGAGG + Intergenic
1001495313 5:172184159-172184181 TTCCAGCCATAACACCAAGATGG + Intronic
1002950307 6:1803218-1803240 TTGAAATAATTGCACCAAGCTGG - Intronic
1003900714 6:10652901-10652923 TTGCCATAATTACAACTAGAAGG - Intergenic
1004577652 6:16913117-16913139 TTGCATTATTTTCAACAAGAAGG - Intergenic
1004995953 6:21193235-21193257 TTGGTTTAAGTACACCAAGAAGG + Intronic
1005234250 6:23741435-23741457 TTTCAGAAATTTCACCAAGATGG + Intergenic
1006508734 6:34509449-34509471 TTGCAGTAATTAAAACAGCATGG - Intronic
1008953307 6:57185001-57185023 TTGCAGTAATAGCAACAAGTTGG - Exonic
1011715243 6:90098298-90098320 TTGAGGTCATTAAACCAAGAAGG - Intronic
1012365975 6:98441155-98441177 TTGTAGATATTTCACCAAGAAGG + Intergenic
1014399452 6:120969405-120969427 TTGCAGTAATTAAAACAGCATGG + Intergenic
1015869751 6:137764117-137764139 TTGCATAAATTACACCATGTGGG + Intergenic
1016703049 6:147075705-147075727 GTGCAGTATGTGCACCAAGATGG - Intergenic
1018284860 6:162226446-162226468 TTGCAGTAATTTGACCCACATGG - Intronic
1018464567 6:164031861-164031883 ATTCAGTCATTATACCAAGACGG - Intergenic
1020450222 7:8313399-8313421 TTGCAAAAAGTACATCAAGAAGG - Intergenic
1021167238 7:17356458-17356480 TTGCAAGAATTACAGAAAGAGGG - Intergenic
1023298195 7:38738788-38738810 GTGCAGTGATTACACTAACAAGG + Intronic
1025572681 7:62596255-62596277 TTGCAGTTACTACAGAAAGATGG + Intergenic
1028384698 7:90241982-90242004 CTGCAGTAATTCACCCAAGATGG + Intergenic
1029366437 7:100119494-100119516 TTGCAGTAATTACACCAAGAGGG - Intronic
1030550312 7:110950341-110950363 CTACAGTAATTACAACAATATGG - Intronic
1032327418 7:130943489-130943511 TTGCAGGAATGAAACCAAAAGGG - Intergenic
1034480362 7:151315127-151315149 TTCCAGGAAACACACCAAGAAGG + Intergenic
1036047144 8:5156267-5156289 TCAGAGTAATTACACCAAGGAGG - Intergenic
1045299448 8:100898650-100898672 TTGCAGTAGTTCCTCCAAAATGG - Intergenic
1045506196 8:102780525-102780547 TTGTAGTGATTCCACCATGACGG + Intergenic
1047095375 8:121619386-121619408 TTGCTATAATTAAACCTAGAAGG - Intronic
1048236300 8:132694082-132694104 TTGCAGTAAATTAAACAAGAGGG + Intronic
1048814368 8:138318253-138318275 TTTCAGTAATTTCATGAAGAAGG + Intronic
1051038012 9:12772711-12772733 TTGCAGTAATGAGTCCAGGATGG - Intergenic
1053176166 9:35925961-35925983 TTGCTGTAAATACACAAAAATGG - Intergenic
1058549544 9:106099133-106099155 TTTCAGTAATCACACTAATATGG + Intergenic
1060853649 9:126897941-126897963 TGGCAGTAGTTAGACCAAGGAGG + Intergenic
1062407185 9:136402556-136402578 TCGCAGGAATTTCGCCAAGAAGG + Exonic
1188633926 X:32404544-32404566 TTGCAGTAATTTAAGCAACAGGG + Intronic
1190628183 X:52357357-52357379 ATGAAGTACTTACACCAAAAAGG - Intergenic