ID: 1029371496

View in Genome Browser
Species Human (GRCh38)
Location 7:100153816-100153838
Sequence CTGTGCTCCCTTCCCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 1, 2: 2, 3: 65, 4: 500}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029371489_1029371496 10 Left 1029371489 7:100153783-100153805 CCCGCCCCATGGAGTCTGTTGCA 0: 1
1: 0
2: 1
3: 8
4: 184
Right 1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG 0: 1
1: 1
2: 2
3: 65
4: 500
1029371492_1029371496 5 Left 1029371492 7:100153788-100153810 CCCATGGAGTCTGTTGCACCCAC 0: 1
1: 0
2: 2
3: 16
4: 98
Right 1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG 0: 1
1: 1
2: 2
3: 65
4: 500
1029371486_1029371496 26 Left 1029371486 7:100153767-100153789 CCAATGTGCGTGTGGCCCCGCCC 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG 0: 1
1: 1
2: 2
3: 65
4: 500
1029371491_1029371496 6 Left 1029371491 7:100153787-100153809 CCCCATGGAGTCTGTTGCACCCA 0: 1
1: 1
2: 5
3: 48
4: 219
Right 1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG 0: 1
1: 1
2: 2
3: 65
4: 500
1029371493_1029371496 4 Left 1029371493 7:100153789-100153811 CCATGGAGTCTGTTGCACCCACT 0: 1
1: 0
2: 0
3: 19
4: 160
Right 1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG 0: 1
1: 1
2: 2
3: 65
4: 500
1029371490_1029371496 9 Left 1029371490 7:100153784-100153806 CCGCCCCATGGAGTCTGTTGCAC 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG 0: 1
1: 1
2: 2
3: 65
4: 500
1029371485_1029371496 30 Left 1029371485 7:100153763-100153785 CCAGCCAATGTGCGTGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 95
Right 1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG 0: 1
1: 1
2: 2
3: 65
4: 500
1029371488_1029371496 11 Left 1029371488 7:100153782-100153804 CCCCGCCCCATGGAGTCTGTTGC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG 0: 1
1: 1
2: 2
3: 65
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029371496 Original CRISPR CTGTGCTCCCTTCCCTCTCC TGG Intronic
900115951 1:1027993-1028015 CTGTGCCCCCTTCTCTCCCCAGG + Intronic
900131735 1:1090114-1090136 CTCTGCTCCCAGCCCTCTGCTGG + Intronic
901154157 1:7124224-7124246 CTGTGCTCTTTTCCCTCTCCTGG + Intronic
901202510 1:7474718-7474740 CTCTGCTCCCTTCTCTGTCCGGG - Intronic
901207720 1:7506293-7506315 CTGGGCTCACTTCCCTCCTCTGG - Intronic
901296234 1:8162753-8162775 CTGTGGTACCTTCCCTCTTGGGG + Intergenic
901642379 1:10699217-10699239 CCGTTCTCCTTCCCCTCTCCTGG + Intronic
901947434 1:12715195-12715217 CTGTGCTTGCTTGCCTTTCCAGG - Intergenic
902856757 1:19211907-19211929 CTGTCCTCCCTTCCCTCTCCAGG + Intergenic
903035741 1:20491520-20491542 CTGTTCTCTCCTCCCTGTCCGGG - Intergenic
903530410 1:24026036-24026058 CTAGGCTCACTTCCATCTCCCGG + Intergenic
903679472 1:25087593-25087615 CAGGGCCCCCTTCCCTCTCTGGG - Intergenic
904013471 1:27403586-27403608 CTCTGCTCCCGCCCCTCTCCCGG + Intergenic
904043466 1:27597242-27597264 CTGTGCTTCCTTCCCTGTACAGG - Intronic
904199517 1:28810946-28810968 CTGTGACCCCAGCCCTCTCCTGG + Intergenic
904350449 1:29901892-29901914 CTCATCTCCCTTCCCTTTCCTGG - Intergenic
904399574 1:30247424-30247446 CCTTGCTCCCTTGACTCTCCCGG + Intergenic
904468787 1:30723338-30723360 CCCTGCTCCCTTCCCCATCCTGG + Intronic
904604970 1:31693092-31693114 CCGTGCTCCCTTCTCTCCCTTGG + Exonic
905374891 1:37513884-37513906 CTGCTCACCTTTCCCTCTCCTGG - Intronic
905878932 1:41451050-41451072 CTGGCCTCCCCTCCCTCTGCCGG + Intergenic
906076100 1:43053303-43053325 CTGTCCCCCCTTCTCACTCCTGG + Intergenic
907341289 1:53738106-53738128 CTGTGCTGTCTCCCCTCCCCAGG - Intergenic
907369461 1:53991500-53991522 CTCTTCTGCCATCCCTCTCCAGG + Intergenic
907438291 1:54463277-54463299 GTGAGCTCCTTTCCCTCTCTGGG - Intergenic
907763804 1:57388542-57388564 CTGAGCCCCATCCCCTCTCCTGG + Intronic
909569059 1:77087511-77087533 CTGTGATCCCATCCTTCTCTGGG + Intergenic
910065175 1:83143367-83143389 CTTTGCTCCTTTCCCAGTCCTGG + Intergenic
912392156 1:109310807-109310829 CTGGGCTCCCCTCCGTATCCTGG + Exonic
912489465 1:110053990-110054012 CAGTGCTCCCATCCCCCACCAGG + Exonic
912933396 1:113983242-113983264 CTGTGCCCCCTTCCCGCACTTGG - Intergenic
913254586 1:116942180-116942202 CTCTGCTCCCTCCTCTGTCCAGG + Intronic
913263865 1:117025585-117025607 CTGAGCTGCCTACACTCTCCAGG - Exonic
913281394 1:117188375-117188397 CACTGCTCAGTTCCCTCTCCCGG - Intronic
915462887 1:156080574-156080596 TTGGGGACCCTTCCCTCTCCTGG - Intronic
915601765 1:156927136-156927158 CTCTGTTCCCTTCCCTTACCTGG + Intronic
915958023 1:160239678-160239700 TTATGCTCCCTTGCCTCACCTGG + Exonic
915973338 1:160368807-160368829 CTGTGGTCCCCTCCCTCTCAGGG - Intronic
916059100 1:161086730-161086752 CTGGGCTCCTTTCCCTGTCAGGG + Intronic
916100663 1:161390538-161390560 CTGTGCTCCCGCCCCGGTCCAGG - Intergenic
917618367 1:176769197-176769219 CTCTTCTCCTCTCCCTCTCCAGG + Intronic
917722856 1:177802654-177802676 CTGGCCTCCTTTCCCTCCCCTGG + Intergenic
917733277 1:177897617-177897639 CAGTGCTCCCTGCTCACTCCTGG - Intergenic
917821506 1:178768644-178768666 CTGTGCTCCCTCCTCAGTCCTGG + Intronic
918111088 1:181456055-181456077 CAGTTCTCCCTTCCCATTCCTGG - Intronic
918379248 1:183937924-183937946 CTGTGCATCCTGCCCTGTCCCGG - Exonic
918472671 1:184890222-184890244 CTGTGTGCCTTTCCCTCCCCAGG - Exonic
918794415 1:188874310-188874332 GTGTGCTCCCTCTCCTCTCAGGG - Intergenic
919128424 1:193425128-193425150 TTGTACTCCATTCCCTCTTCAGG + Intergenic
919470064 1:197967238-197967260 CAGTGTGCCCTTCCCTCCCCAGG + Intergenic
919518516 1:198557156-198557178 CCAGCCTCCCTTCCCTCTCCCGG - Intergenic
921042112 1:211442795-211442817 CTGGGCTCCCTTCACTGTCCAGG - Intergenic
921302633 1:213765307-213765329 CTCTACTCCAATCCCTCTCCGGG + Intergenic
922029317 1:221782731-221782753 CTTTGCTCCCTTCCTTTTGCAGG - Intergenic
922215195 1:223514615-223514637 CTGTCCTCCCTTCCTTCTGATGG - Intergenic
923430911 1:233919566-233919588 CTATGCTACCTGCCCACTCCTGG - Intronic
924375939 1:243409030-243409052 CTGTACTCCATTGCCTCTCAAGG + Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063108840 10:3017607-3017629 CTCTGCTCCCAGCCCACTCCGGG - Intergenic
1063908950 10:10810565-10810587 CTCTTCTCTCTTCCCTCTGCTGG - Intergenic
1064081021 10:12308123-12308145 ATGAGTTCCTTTCCCTCTCCAGG + Intergenic
1064884711 10:20098204-20098226 CAGTGCTGCCTTCCCTCTGTAGG + Intronic
1067298651 10:44990623-44990645 GTGTGCCCCCGTCCCTCTCTAGG - Intronic
1067328187 10:45289772-45289794 CTGTCCTCTCTTGCCTCTTCTGG + Intergenic
1067839903 10:49667198-49667220 CTTTCCTCCCTTTTCTCTCCTGG - Intergenic
1067839997 10:49668080-49668102 CTCTCCTCCCTTTTCTCTCCTGG - Intergenic
1068388344 10:56360383-56360405 CTGTGTTTCCTTGCCCCTCCAGG - Exonic
1069867461 10:71512601-71512623 CTGCCCTCTCTTCCCTCTCATGG + Intronic
1069881896 10:71598427-71598449 CTTTGCTCCGGGCCCTCTCCAGG + Intronic
1070312333 10:75282894-75282916 GTCAGCTCCCTTCCCTCTCTGGG + Intergenic
1070354172 10:75623298-75623320 CTCTGCTCCCCTCCCTTTCCTGG + Intronic
1070686697 10:78490100-78490122 CTGTCCCTCCTTCCTTCTCCTGG - Intergenic
1071170451 10:82858023-82858045 CTGTGCTCCTTTCCCACTGTGGG + Intronic
1072868598 10:99091642-99091664 CTGTGCTCCATTCCCTATTGTGG + Intronic
1072930606 10:99659203-99659225 CTGTGCCCGCTTCCCTCCCTGGG - Intergenic
1073871284 10:107867803-107867825 CTGTATTCCCTCCCCTCTCTTGG - Intergenic
1074686013 10:115963142-115963164 CTGTGGTCCCTGCACCCTCCAGG - Intergenic
1074738318 10:116459403-116459425 CTCTGCATCCTTCCCACTCCGGG + Intronic
1075384630 10:122046624-122046646 CCGTGGTCCCTTTCTTCTCCTGG + Intronic
1075670808 10:124262990-124263012 CTGAGCTCACTGCCCACTCCAGG + Intergenic
1076287591 10:129315262-129315284 GTTTGATCCATTCCCTCTCCTGG - Intergenic
1076441214 10:130482575-130482597 CTGTGGTCCCTGCCCTCCCAAGG - Intergenic
1076454211 10:130578234-130578256 CCGTGCTTCCTTCCCTGTGCTGG + Intergenic
1076481482 10:130787954-130787976 CTGTGCTCCCTGCCATGTGCAGG - Intergenic
1076544658 10:131237146-131237168 CTGTGGGCCATTCCCTCTGCTGG + Intronic
1076580123 10:131502112-131502134 TTGTGCTCCCTTCCCTCCAATGG + Intergenic
1076631896 10:131856574-131856596 CTTTGCTCCTTTCCCTCCTCAGG - Intergenic
1077356182 11:2119781-2119803 CTTTGCTCTCTTCCCTCACAAGG + Intergenic
1077847299 11:6039519-6039541 CAGTGCCTCCTTCCTTCTCCTGG + Intergenic
1078039776 11:7849233-7849255 CTGTGCTGACCCCCCTCTCCTGG + Intergenic
1078084747 11:8227100-8227122 CTCTGCGCCCTTCCCTCGGCAGG - Exonic
1078624436 11:12941062-12941084 CTTTGGTCCCTGGCCTCTCCTGG + Intronic
1079237205 11:18699204-18699226 CAGCGGTCCCCTCCCTCTCCCGG - Intronic
1081596764 11:44464656-44464678 CTGTTCTACTTTCCATCTCCAGG + Intergenic
1081858875 11:46320688-46320710 CTGGCCTCTCTTCTCTCTCCAGG + Exonic
1083333297 11:61909059-61909081 TCGCCCTCCCTTCCCTCTCCAGG - Intronic
1083778003 11:64903551-64903573 CTGGGCTCCCTCCCCTCTGAGGG - Intronic
1083883116 11:65558045-65558067 CGCTGCCCCCTACCCTCTCCCGG - Exonic
1084285676 11:68128927-68128949 CTGTGGTCCCTACCCCCGCCCGG + Intergenic
1084444472 11:69195764-69195786 CTGTGGTCCCTTCCATCTCTGGG + Intergenic
1084587973 11:70074217-70074239 CCATGCTCCTTTCCCTCCCCTGG + Intergenic
1084697213 11:70762833-70762855 CTGTGCTTCCCTCCTCCTCCGGG - Intronic
1084973268 11:72782641-72782663 CTGGGCTCTCTTACCTCCCCAGG + Intronic
1084982424 11:72837518-72837540 TTGTGCTCCCTACCTTCTACAGG + Intronic
1085114829 11:73921645-73921667 CCGTGCTCCTTTCACTGTCCAGG + Intronic
1085129734 11:74028113-74028135 CTGAGCTCCCTGCCCACTGCTGG + Intronic
1085472825 11:76769072-76769094 CTCTGTTACCTTCCCTCTCAAGG + Intergenic
1086369670 11:86143821-86143843 CTGTGGTCACTTCCCTCCCCTGG - Intergenic
1087132705 11:94682305-94682327 CTATGCTCCTTTCCTTCTCAAGG - Intergenic
1087655861 11:100922221-100922243 CTGTGCTCCCCTTCCTCACAGGG + Intronic
1088115478 11:106307146-106307168 CTGTCCTGCCTGCCCTCTGCTGG - Intergenic
1088379028 11:109173081-109173103 TTGTCCTCCCTTCTATCTCCTGG + Intergenic
1088544577 11:110946700-110946722 CTCTCTTCCCTTCCCACTCCAGG + Intergenic
1088821311 11:113460219-113460241 CAGTGGACCCTGCCCTCTCCTGG + Intronic
1089302953 11:117509582-117509604 CTGGGCTCTCTTCCCCCTCCAGG - Intronic
1089412040 11:118252240-118252262 CTGCGCTCTCTTCCCTCTGCTGG - Exonic
1089713780 11:120336673-120336695 CTGTGCTCGCCGCCCTCACCAGG - Intergenic
1090138399 11:124225265-124225287 TTGTGATCTCTTCCCTCTCTTGG + Intergenic
1090854883 11:130602567-130602589 CTGTGTTGCCTTCCCTTTCTGGG + Intergenic
1091780757 12:3213320-3213342 CTCTGCCCCCTGCCCTCTCAAGG + Intronic
1092009164 12:5095101-5095123 ATGTGCTCCCTCACCTTTCCTGG - Intergenic
1092503657 12:9072797-9072819 CTGTGCAGCCTTCCCAGTCCTGG + Exonic
1093377013 12:18441632-18441654 CTTTGCTTCCTTCACTCTACAGG - Intronic
1093993722 12:25618621-25618643 CTATGTTCCCTTTCCTTTCCAGG - Intronic
1094526709 12:31235892-31235914 CTCAGCTGCCATCCCTCTCCTGG + Intergenic
1096229371 12:49888785-49888807 CAGTACTCCCTTCCCTGCCCAGG + Intronic
1096368452 12:51048199-51048221 CTTTGAGTCCTTCCCTCTCCTGG + Intronic
1096505147 12:52087940-52087962 CTGGGCTCCCTGCCCTTCCCTGG + Intergenic
1096777094 12:53970889-53970911 CTCTGCTTCCTTCCCCCTCCTGG - Intergenic
1099202398 12:79691051-79691073 CTCGGCTCCCTTCCCGCCCCTGG - Exonic
1100295541 12:93257558-93257580 CTCTGCTACCTCCCCTCACCAGG + Intergenic
1100612370 12:96202121-96202143 CTCTGATCCCTTCTCTCCCCAGG + Intronic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1101346493 12:103890764-103890786 CTGTGTTGCCCTCCATCTCCAGG - Intergenic
1101720906 12:107350081-107350103 CTCTGTTTCCTTCCCTCTCAAGG + Intronic
1101821850 12:108190547-108190569 CTGTGGTTCCTTACCTCCCCTGG - Intronic
1102120297 12:110435144-110435166 CCGGGCTCCCTTCACTGTCCAGG + Exonic
1103040596 12:117692007-117692029 CTGTGTTCCTTTGCCTCTGCGGG + Intronic
1103681502 12:122697621-122697643 TTGAGCTCCCTTCCCTTTCGAGG - Intergenic
1103683234 12:122711052-122711074 TTGAGCTCCCTTCCCTTTCGAGG - Intergenic
1103949632 12:124543753-124543775 CTGCGCTCCCTGCCCTGTCGTGG - Intronic
1104645653 12:130495463-130495485 CTGCGCTCCCCTCTCCCTCCAGG + Intronic
1105295468 13:19085338-19085360 CTGTGTTCACTGGCCTCTCCTGG - Intergenic
1105630179 13:22156207-22156229 GCATGCTCCCTTCCTTCTCCTGG + Intergenic
1106251685 13:27986853-27986875 CTGTGGTCCCTTCACTCATCAGG + Intronic
1106398333 13:29403309-29403331 CTTGTGTCCCTTCCCTCTCCAGG + Intronic
1107828391 13:44351428-44351450 ATGTGCACCCTTCTCTCCCCAGG + Intergenic
1111414584 13:87922746-87922768 ATGTTCTCCCTTCTCTGTCCTGG + Intergenic
1112379306 13:98873426-98873448 CTGTTCTCTCTTCCCTCTCATGG + Intronic
1112426260 13:99304119-99304141 CTGAGCTCCATTCCTTCTTCAGG + Intronic
1113220065 13:108089964-108089986 GTGTCCTTCCTTGCCTCTCCTGG - Intergenic
1113552505 13:111204150-111204172 CTTCGGTCCCTTCCCTTTCCTGG - Intronic
1113555177 13:111228115-111228137 CTGTGCTCTCTGCTCTCTACTGG + Intronic
1113910244 13:113838281-113838303 CTGGGCTCCCTCCCTGCTCCAGG - Intronic
1113910293 13:113838439-113838461 CTGGGCTCCCTCCCTGCTCCAGG - Intronic
1116781271 14:49240578-49240600 CTGAGCTCCCTACTCACTCCTGG + Intergenic
1116919691 14:50560207-50560229 CTGCGCTCGCTGCCTTCTCCGGG - Exonic
1118348798 14:64959020-64959042 CTAAGCTCCCTTGCCTCTGCTGG - Intronic
1118753946 14:68824661-68824683 CTGTGCACCCCACCCCCTCCAGG - Intergenic
1119130112 14:72164227-72164249 CAGAGATGCCTTCCCTCTCCTGG - Intronic
1119245569 14:73103428-73103450 CTGAGCTCCTTTCTCTATCCCGG - Exonic
1121260087 14:92559628-92559650 ATGTGCTCTCTTCCTGCTCCAGG - Intronic
1121562302 14:94884595-94884617 CTCTGCTTCCCTCCCTCTCTTGG - Intergenic
1121675926 14:95752914-95752936 CTGTGTGCCCTTTCCTATCCTGG - Intergenic
1122283235 14:100636556-100636578 CTGTGATGCCTGCCCTGTCCCGG + Intergenic
1122822360 14:104353992-104354014 CTCTGCACGCTTCCCTCTGCTGG - Intergenic
1123032464 14:105458421-105458443 CTGTTCTCCCTTCCCTGTGGTGG + Intronic
1124591868 15:31060984-31061006 CTGTCCTCCCTGCCCCCTCATGG + Intronic
1125300560 15:38250824-38250846 CTCTTCTACCATCCCTCTCCAGG - Intergenic
1127319692 15:57831110-57831132 ATGTGCTCCTATCTCTCTCCTGG + Intergenic
1127383729 15:58451005-58451027 CAGTGCTGCCTTCCTTCCCCAGG + Intronic
1127637215 15:60882486-60882508 CTGTCATCCCTTCCCTCCCTAGG - Intronic
1128648772 15:69395742-69395764 CTGCGCTGCCTCACCTCTCCGGG + Intronic
1128830808 15:70766842-70766864 CTGTGTTCTCTTCCCTGTTCTGG - Intergenic
1128894189 15:71357574-71357596 CCTTGCTCCCTTTCCCCTCCTGG + Intronic
1129205811 15:74036458-74036480 CTGTTCTCTCTTCCCTATGCTGG + Intronic
1129301310 15:74627184-74627206 CTGTGCTGGCCTCCCTCTCAAGG - Intronic
1129671455 15:77610148-77610170 CTGTGCTGCTTTCAGTCTCCTGG + Intergenic
1129944076 15:79524208-79524230 CACTCCTCCCTTCCCACTCCTGG + Intergenic
1130048451 15:80464131-80464153 CTTTGCTCCCTAGTCTCTCCGGG + Intronic
1131300270 15:91193473-91193495 CTGTGCTTCCTTCTCTTTCTTGG + Intronic
1132144122 15:99416791-99416813 CTTTGCTCCCAGCCCTCCCCTGG + Intergenic
1132252027 15:100341519-100341541 CTGCCTTCCCTTCCCTCGCCCGG + Intronic
1132300263 15:100770992-100771014 CTGAGCCCCCTTCCCTCCCCGGG + Intergenic
1132666522 16:1083486-1083508 CTCTGCCCCCTTCCCTCCCCAGG - Intergenic
1133112517 16:3557034-3557056 CTGTTTCCCCTTCCCTCTCTGGG - Intronic
1133483355 16:6193820-6193842 CTGTTCTTCCTTCATTCTCCTGG + Intronic
1134353619 16:13461168-13461190 CTGTGCACACTTGCCTCTCTTGG + Intergenic
1134421090 16:14090575-14090597 GACTGCTCCCTTCCCCCTCCTGG - Intronic
1134794293 16:17020506-17020528 CTGTCCTCCTTTTCCTCACCTGG + Intergenic
1135210294 16:20520202-20520224 CATTCCTCCCTTCCTTCTCCAGG - Intergenic
1135968486 16:27055059-27055081 CTGTGCTTCGTGCCCTCTGCTGG + Intergenic
1135971977 16:27078890-27078912 CTTTGCTCCCTTCTCTGCCCAGG - Intergenic
1136172465 16:28497141-28497163 CTGTGCTTCCGTCCAGCTCCTGG - Exonic
1136461338 16:30412161-30412183 CTTTGCTCCCTGCTTTCTCCAGG + Intronic
1136545257 16:30950790-30950812 GGCTGCTCCCTTCCCTCTGCAGG - Intronic
1137812278 16:51364258-51364280 GTGTCCTCCCTTCTCTCTGCAGG + Intergenic
1139340066 16:66262679-66262701 CTGTGCTCAAGGCCCTCTCCTGG + Intergenic
1140686046 16:77434871-77434893 CTGCGCGCCCTCCCTTCTCCCGG + Exonic
1140894247 16:79311124-79311146 CTGGGTTCCCTTCCTTCGCCAGG + Intergenic
1141131181 16:81438064-81438086 CTCTCCTCCCTTCCCACTGCTGG + Intergenic
1141206332 16:81935706-81935728 CTGTTCTCCCTTCCCTGCACAGG + Intronic
1142284312 16:89165532-89165554 CAGTTCTCACTGCCCTCTCCGGG + Intergenic
1142752761 17:1998412-1998434 CTGGGATCCGTTCCCTCTCGCGG + Intronic
1142839120 17:2613425-2613447 CTGTGCTGAGTTCCCTCTCTGGG + Intronic
1143100418 17:4501523-4501545 CTGTGCCTCCCTCCCTCTCCTGG + Intronic
1144585438 17:16484836-16484858 CTGTGCTCCTGTGTCTCTCCTGG + Intronic
1144646701 17:16979965-16979987 CTGTGCTTCTTTCTCACTCCAGG + Intergenic
1144653253 17:17019926-17019948 TTGTGCTCACCTCCCTGTCCAGG + Intergenic
1144696705 17:17308756-17308778 CTGTGCTCCCTGCCAGCCCCTGG + Intronic
1144807735 17:17978731-17978753 CTGTGCCCCTTTACCCCTCCCGG - Intronic
1145961226 17:28887561-28887583 CTGCTCTCCCTTCCTGCTCCAGG - Intronic
1146260153 17:31415664-31415686 CTGAGCTCCTTCCCCTCTCTCGG - Intronic
1146913430 17:36662862-36662884 CTGTGCTCCCTTCCTCCTACAGG - Intergenic
1148158255 17:45435718-45435740 CTCTTCTCCCTGCCCACTCCTGG + Intergenic
1148251138 17:46081938-46081960 CTGTGATTCCTTCTCTTTCCTGG - Intronic
1148347485 17:46913025-46913047 CTGTGCTCCCATCCGCCTCATGG - Intergenic
1148559421 17:48597445-48597467 TCCTGCTCCCTTCCCTGTCCTGG + Intronic
1148669778 17:49402073-49402095 CTGCTCTCCCTTCCCTGGCCAGG + Intronic
1148905659 17:50910233-50910255 CTGTGCTCCCCTCGCCCTCTGGG - Intergenic
1149243606 17:54679491-54679513 CAGTGCTGCACTCCCTCTCCAGG - Intergenic
1149684187 17:58526136-58526158 CTATACTCCCTTCCCACTCACGG + Intronic
1150001065 17:61440359-61440381 CTGTGCCAGCTTCCCTCTCATGG - Intergenic
1150339893 17:64357937-64357959 CTGTCCTTCCTTCCATCTTCTGG + Intronic
1150392765 17:64799770-64799792 CTGCTCACCCGTCCCTCTCCTGG - Intergenic
1151257062 17:72886104-72886126 CTCTGCTCAGTTCCCTCTGCTGG + Intronic
1151800709 17:76377822-76377844 CTGTGTTCCCTTGCCTTTTCTGG - Intronic
1152123160 17:78431344-78431366 CTGTGCCCCTCTCCCCCTCCTGG + Intronic
1152267547 17:79305088-79305110 CTGTGCTTCCTGCCCTGGCCAGG - Intronic
1152439615 17:80298074-80298096 CTGAGATCCCTCCCCTGTCCTGG + Intronic
1152452374 17:80389955-80389977 CTGCGCTCCCTTCTCCCTGCAGG + Intronic
1152532208 17:80925208-80925230 CTCTGCTCACTTCCGTATCCTGG - Intronic
1152567431 17:81106558-81106580 CTGGCCTCCCTTCCTCCTCCTGG - Intronic
1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG + Intronic
1152861169 17:82697870-82697892 CTGTGCTCCTTCCTCTCCCCCGG + Intronic
1153367021 18:4268029-4268051 CTCTGCTCACCACCCTCTCCTGG - Intronic
1153981637 18:10315418-10315440 CTGCACTCCCTGCCCTCTCTGGG - Intergenic
1154045950 18:10904966-10904988 CTGTGCTTCCTGCCCACCCCTGG - Intronic
1155284301 18:24272195-24272217 CTGTGCGCTCGGCCCTCTCCTGG + Intronic
1155461781 18:26091136-26091158 TTGACCTCCCTCCCCTCTCCGGG - Intronic
1158974269 18:62696704-62696726 CTTTCCTCCCTTCCTTTTCCTGG + Intergenic
1159937748 18:74382435-74382457 CTCTTTCCCCTTCCCTCTCCTGG + Intergenic
1160339381 18:78074661-78074683 CTGTGCTTCCTTCCTGCTTCAGG + Intergenic
1160536650 18:79598029-79598051 GTGAGCTCCCGGCCCTCTCCCGG - Intergenic
1160698758 19:496657-496679 CTGGGCCCCCTCCTCTCTCCCGG - Intronic
1160698768 19:496676-496698 CTGAGCCCCCTCCCCTCTCCTGG - Intronic
1160698994 19:497335-497357 CCGGGCCCCCTCCCCTCTCCCGG - Intronic
1160973423 19:1780421-1780443 CTGTGCCCCTTTCCACCTCCAGG - Exonic
1160989114 19:1853399-1853421 CTGGCCTCCCCTCCTTCTCCTGG - Exonic
1161145957 19:2678217-2678239 CTGTGGTCACTTCCATCTCAGGG + Intronic
1161266616 19:3367259-3367281 CGGAGCACCCTTCCCCCTCCTGG - Intronic
1161809003 19:6460646-6460668 CTGGGCTCCCTTCCCCCTAATGG - Intronic
1162109783 19:8393722-8393744 CAGTGCCCCCATCCCTCCCCTGG - Intronic
1162794150 19:13078111-13078133 GTGTGCTCCCTTCCCTAAACGGG + Intronic
1163262708 19:16200775-16200797 CAGTGCTCCCTTCCGCTTCCAGG + Intronic
1163534378 19:17868805-17868827 CTCTGCTGCTTTTCCTCTCCAGG + Intergenic
1164635331 19:29787414-29787436 CTGTCCTCCCTCCTCTCTTCTGG - Intergenic
1165392516 19:35546596-35546618 CTGAACTCCCTTCCCTTCCCTGG - Intronic
1165830649 19:38728740-38728762 CTCTGCACCCTCCCCTCTCGTGG - Intronic
1166711758 19:44942209-44942231 CTGTGCAGCCTCCCCTCCCCCGG + Intergenic
1166941752 19:46371203-46371225 CTGTGCTCCCTGGCCCTTCCTGG + Intronic
1167333132 19:48868652-48868674 CTGTTCTCCCCTCCCAATCCCGG + Intergenic
1167459240 19:49615598-49615620 CTCTGTTCCCCTCCCTCTCTGGG - Intronic
1167690395 19:50981294-50981316 CTCTGTCCCCTTCTCTCTCCGGG - Intronic
1168333164 19:55581007-55581029 CTGCCTTCCCTCCCCTCTCCAGG - Intergenic
924998767 2:387001-387023 CCCTGCTCCCTTCTCTGTCCTGG + Intergenic
925038086 2:707200-707222 ATCTTCTCCCCTCCCTCTCCTGG + Intergenic
925901193 2:8510631-8510653 CTGTGTTCTGTCCCCTCTCCTGG - Intergenic
926227585 2:10979239-10979261 CTGTACTATCTTCCCTCTACTGG - Intergenic
926554687 2:14342607-14342629 CTGTGCTCCGTTCACGCTACTGG - Intergenic
927636260 2:24819568-24819590 CTGTGCTCCCTCCACAGTCCCGG + Exonic
927853052 2:26511822-26511844 CTCTGCTGCCTTCCTTCTCCAGG - Intronic
927993535 2:27465518-27465540 CTTTGCTTCCTTCCCTTTCCAGG - Exonic
928332704 2:30369869-30369891 CTGTGCTCACTTCCACCCCCTGG + Intergenic
928909846 2:36408549-36408571 CAGAGCTCCCTTCCCTCTAAGGG + Intronic
929222984 2:39484584-39484606 CTGTGACCCATTCCCTCACCTGG + Intergenic
929557886 2:42936836-42936858 CTCTGGGCCCATCCCTCTCCAGG + Intergenic
930530106 2:52579612-52579634 CTGTGCTCCCTGCTCGTTCCTGG + Intergenic
930610665 2:53539451-53539473 GTATGCACTCTTCCCTCTCCTGG + Intronic
930878849 2:56249331-56249353 CTTTGCTCCCATCCCTTGCCAGG + Intronic
931228200 2:60352006-60352028 CAGGGCTCCCTTCCCCCTTCTGG + Intergenic
931371553 2:61667812-61667834 CTCTCTTCACTTCCCTCTCCAGG - Intergenic
931805643 2:65801179-65801201 CTGAGCACCCTGCCCTCTGCTGG + Intergenic
932341342 2:70964454-70964476 ACGTGCTCCCTTCCCTGTCGCGG + Exonic
933950711 2:87326875-87326897 CAGTCCTCCCTTCCCACTCTGGG - Intergenic
935061680 2:99614118-99614140 CTCTACTCCCATCCCACTCCTGG - Intronic
935241268 2:101180124-101180146 CAGGGCTCACTTCCCTCTGCAGG - Intronic
935280944 2:101517229-101517251 CTGTGCTTACTTCCCCCTTCTGG - Intergenic
935408333 2:102733386-102733408 TTGTTCCCCCTTCCCTGTCCTGG + Intronic
935595834 2:104876873-104876895 CTGTGCTGCTTTCGCTCTTCAGG + Intergenic
936165301 2:110115462-110115484 CTGTGCTCGCTCCCCGCTCTCGG + Intronic
936502012 2:113074091-113074113 CTGTGCTTCCTGCCTTCTCATGG - Intronic
936628065 2:114170022-114170044 CTGTGCTGCCTTGGGTCTCCTGG + Intergenic
936982365 2:118276454-118276476 CTGTGACCCCTTCCCTCTTCTGG - Intergenic
937235989 2:120432290-120432312 CTGAGCTCCCTTCCTCCCCCGGG + Intergenic
937265439 2:120612202-120612224 CCGTGCACCCTCTCCTCTCCAGG + Intergenic
937828183 2:126390388-126390410 CTGGTCTTCTTTCCCTCTCCTGG - Intergenic
937875641 2:126823383-126823405 CTCTCCTCTCTTCCCTCTCCTGG + Intergenic
937937730 2:127259529-127259551 CTTTGGTCACTTCCCTCCCCAGG + Intronic
938019397 2:127893612-127893634 CTGTGCTCCCTCCTCCTTCCCGG - Intergenic
938639374 2:133264486-133264508 CTTTGCTCCATTCCCACCCCCGG + Intronic
941665993 2:168245249-168245271 CTCTGCTTCCTTCTCTTTCCTGG + Intronic
943615547 2:190087865-190087887 CTCTTCTCCCTTCCTTCTCCAGG + Intronic
943940331 2:193986193-193986215 CTAAGCTCCTTTCCATCTCCTGG + Intergenic
944389573 2:199203571-199203593 ATGCTCTCCCTTGCCTCTCCTGG + Intergenic
945019395 2:205556093-205556115 ATGTGCTCGCCTCACTCTCCTGG - Intronic
945941925 2:215959063-215959085 CTCAGCTCTCTTCCCTCTGCTGG + Intronic
946052711 2:216877464-216877486 CTGTGTTCCGTTGCCTCCCCAGG + Intergenic
946516123 2:220412975-220412997 CTCTGCTCTCTTCCCTGTCTGGG - Intergenic
946662353 2:222015046-222015068 CTGTTCTCCCTGCCCTGTTCTGG - Intergenic
946844434 2:223846911-223846933 CACTGCTCCTGTCCCTCTCCAGG + Intergenic
947911518 2:233803846-233803868 CTGGGCTCCCTCCCCACCCCAGG - Intronic
948100118 2:235366520-235366542 CTGTGCTCCAGCCCCTCCCCTGG - Intergenic
948280149 2:236740753-236740775 CTGGTCTCCCTAACCTCTCCAGG - Intergenic
948395627 2:237642908-237642930 CAGCCCTTCCTTCCCTCTCCAGG - Intronic
948650822 2:239442570-239442592 CTGTGCTGCCTTCTGTCTCCTGG - Intergenic
948955615 2:241288110-241288132 GTGTCCTCTTTTCCCTCTCCAGG - Intronic
948965053 2:241372748-241372770 CTGGGCTCTCTTGCCTCTGCTGG + Intronic
949047340 2:241877946-241877968 CTCTGCTCCCCTCCCTCTCCTGG + Intergenic
949047359 2:241877992-241878014 CCTCGCTCCCCTCCCTCTCCCGG + Intergenic
949047403 2:241878085-241878107 CCTCGCTCCCCTCCCTCTCCCGG + Intergenic
949047423 2:241878128-241878150 CCTCGCTCCCCTCCCTCTCCCGG + Intergenic
1168880804 20:1204595-1204617 CTGAGCTGCCTCCTCTCTCCTGG - Intronic
1169262686 20:4149469-4149491 CTGTGCTGACTTCCCCCTCTGGG + Intronic
1170390276 20:15865773-15865795 CTGGGCTCCCTGCCACCTCCAGG - Intronic
1171173237 20:23033997-23034019 CCGTGCTCCCATCCCACACCTGG + Intergenic
1171779944 20:29409665-29409687 CTGTTCTTCCCTCCCTCCCCTGG + Intergenic
1171823927 20:29877945-29877967 CTGTTCTTCCTTCCCTCCCCCGG + Intergenic
1171896154 20:30812392-30812414 CTGTTCTTCCCTCCCTCCCCCGG - Intergenic
1172777526 20:37416163-37416185 GTGTCCTTCCTTCCCTCTCTGGG + Intergenic
1172952424 20:38730594-38730616 CCCTCCTCCCTTCCCACTCCAGG - Intergenic
1173005695 20:39138141-39138163 CTGAGCTCCCCTTCCTCGCCAGG - Intergenic
1173211876 20:41040468-41040490 TTCTCCTCCCTTTCCTCTCCTGG - Intronic
1173367697 20:42402078-42402100 CTCTGCTCCCCTCCTTCACCTGG - Intronic
1173672356 20:44807572-44807594 CTCTTCTCCCCTCCCTCCCCTGG - Intronic
1173903705 20:46610446-46610468 CTGTGTTCTCTTCACTCTCCTGG + Exonic
1174241055 20:49135005-49135027 CCGGGCTCCCTTCGCTGTCCAGG - Intronic
1174832241 20:53823520-53823542 CTGTGCTCCCATCCCTCCCATGG - Intergenic
1175618955 20:60427113-60427135 CTGGGCTCACTGCCCTCCCCTGG - Intergenic
1175935989 20:62514256-62514278 CTGGGCACCCTTCCCTCCCCTGG - Intergenic
1175987567 20:62771542-62771564 CTGGGGTCTCTGCCCTCTCCGGG + Intergenic
1176025704 20:62984454-62984476 CTGACCTCCCTGCCCTGTCCTGG + Intergenic
1176101132 20:63365086-63365108 CTGTGCTCCCATCCCCCCCAAGG + Intronic
1176101407 20:63366128-63366150 CCCAGCTCCCTGCCCTCTCCTGG + Intronic
1176101419 20:63366168-63366190 TAGTGCTCCCTGCCCTCTCCTGG + Intronic
1176101435 20:63366228-63366250 TAGTGCTCCCTGCCCTCTCCTGG + Intronic
1176101441 20:63366248-63366270 TGGTGCTCCCTGCCCTCTCCTGG + Intronic
1176101447 20:63366268-63366290 TGGTGCTCCCTGCCCTCTCCTGG + Intronic
1176232186 20:64038274-64038296 CCTTCCTCCCTTCCCTCCCCAGG + Intronic
1176385773 21:6137993-6138015 CTGTGCTCCGTGCCCACCCCGGG + Intergenic
1176726371 21:10438001-10438023 CTCAGCTCACTTCCATCTCCTGG + Intergenic
1177668290 21:24190938-24190960 CTAAGCTCCCTCCCCTCACCAGG + Intergenic
1177900817 21:26913128-26913150 CTGGGTTCCCCTCCCTCTCCAGG - Intergenic
1178807044 21:35847879-35847901 ATGTGCTCCATGCTCTCTCCTGG + Intronic
1179737700 21:43400259-43400281 CTGTGCTCCGTGCCCACCCCGGG - Intergenic
1180052346 21:45337023-45337045 CTGGGCTTCCTTCCCACCCCAGG - Intergenic
1180220223 21:46353914-46353936 GTGTGCGCCATTCCCTCCCCAGG - Intronic
1180288007 22:10769087-10769109 CTCAGCTCACTTCCGTCTCCTGG - Intergenic
1180701199 22:17782239-17782261 CTCCACTCCCTTCCCTCTGCTGG - Intergenic
1181005655 22:20012249-20012271 CTCTGCTCCCACCCATCTCCTGG - Intronic
1181019864 22:20094065-20094087 CTGTGTGCTCTTCCCTCTGCGGG + Intronic
1181863089 22:25834449-25834471 ATGTGCCCCTTCCCCTCTCCAGG + Intronic
1182119985 22:27780187-27780209 CTGTGCTCCACACCCTCCCCTGG + Intronic
1182401635 22:30082098-30082120 CTGTGCTCCCTTCCAGCTTTAGG + Intronic
1182735850 22:32532029-32532051 CTGTGAGCCCCTACCTCTCCGGG - Intronic
1182822087 22:33225199-33225221 CCGTCCTACCTTGCCTCTCCTGG - Intronic
1184667300 22:45995819-45995841 CTGTGCTCCGTTCCTTCTCACGG + Intergenic
951981864 3:28575547-28575569 CCCTGGTCCCCTCCCTCTCCCGG - Intergenic
952646150 3:35661721-35661743 CTGTGCCTCATTCTCTCTCCAGG - Intronic
952974589 3:38682932-38682954 CAGTGCTCCCTGCCCTTTTCAGG - Intergenic
953108376 3:39908191-39908213 CTGCTCTCCCTTCCTTCCCCTGG - Intronic
954577380 3:51684097-51684119 CTCTCCGCCCTTCCCTCTCCTGG + Intronic
954705847 3:52480137-52480159 CTGTGCTTCCTCTTCTCTCCCGG + Intronic
955078591 3:55637042-55637064 CTGTCTTCCTGTCCCTCTCCTGG + Intronic
957911323 3:86622717-86622739 AGGTGCTCCCTTAGCTCTCCAGG - Intergenic
960857596 3:122119180-122119202 CTCTGCTGCCTGCCCTCTGCAGG - Intronic
961167860 3:124776046-124776068 CTGGCTTTCCTTCCCTCTCCTGG - Intronic
961384932 3:126517958-126517980 CTGGGCTCACTTCCCCTTCCAGG + Intergenic
961446908 3:126985198-126985220 CAGTGTCCCCTTCCCTTTCCTGG - Intergenic
961483043 3:127196406-127196428 CTGTGCACCCCTCCCACTGCAGG + Intronic
961574290 3:127822515-127822537 CGGGGCTCCCCTCCCTCCCCAGG + Exonic
962265663 3:133942678-133942700 CTGTGCCCACTTCCTGCTCCCGG - Exonic
962499819 3:135979795-135979817 CTCTGCCTCCTTCCCTCTCTTGG - Intronic
962575610 3:136752456-136752478 CTCAGCTCCCTCCCCTTTCCGGG - Intergenic
962805236 3:138922361-138922383 ATGTGGTCTCTGCCCTCTCCAGG - Intergenic
963051065 3:141144404-141144426 CTGTGCTTCCTTTCCTATCCAGG + Intronic
963837022 3:150068032-150068054 CTATGATCTCTTCCCTCTGCTGG + Intergenic
965558117 3:170038052-170038074 CCGTGCTCCCCTGCCCCTCCCGG + Exonic
966837477 3:184060040-184060062 CAGTGCTGGCTTCCCTCACCAGG - Exonic
966970367 3:185040017-185040039 CTTCCCTCCCCTCCCTCTCCTGG - Intronic
967862123 3:194160219-194160241 GTGCCCTCCCTTCCCTGTCCAGG + Intergenic
968273852 3:197424963-197424985 CTGTGCAACCTTCCTTCTCCCGG - Intergenic
968578000 4:1376841-1376863 CTGTCCTCCCCACCCTCTCCCGG - Intronic
968768141 4:2485522-2485544 CTGTTCTCCCTTCCCTCATTGGG + Intronic
969058968 4:4420129-4420151 CTGTGCTCCCGTCCCTGCCCAGG - Exonic
969606544 4:8204933-8204955 CTGTGCTCCCTTCCTCCACGGGG - Intronic
970458274 4:16247081-16247103 TTGTGCTCACTTCCCTCCCTGGG + Intergenic
973274980 4:48297358-48297380 CTGTTTTCCCTTCTATCTCCTGG + Intergenic
974716219 4:65670769-65670791 CTGATCTCCCTTCCGCCTCCCGG - Intergenic
975167088 4:71188321-71188343 CTATCCTTCCTTCCCTCTCAAGG + Intronic
975837759 4:78442351-78442373 CTTTGCTCCTTTCCCTGTCCTGG - Intronic
978554479 4:109964178-109964200 CTCTGGTTTCTTCCCTCTCCAGG - Intronic
980133568 4:128839266-128839288 CTGCTCTGCCTTCCATCTCCAGG - Intronic
980226863 4:129998406-129998428 CTCTTTTCTCTTCCCTCTCCTGG - Intergenic
980878100 4:138682679-138682701 TCCTGCTCCCCTCCCTCTCCTGG + Intergenic
981660155 4:147157445-147157467 CTGTGCTGCCTTCCATCCCAGGG - Intergenic
985516911 5:351418-351440 CTGTGCTTCCTTCCTTTTCAGGG - Intronic
985763615 5:1764911-1764933 CTGTGGTCCCTGCCCTGTGCTGG + Intergenic
986834309 5:11617809-11617831 CTGTATTCCCTTCCCTTTCTGGG - Intronic
987024054 5:13906099-13906121 CTATTCATCCTTCCCTCTCCCGG - Intronic
988962638 5:36385198-36385220 CAATGGTCCCTTCCCTATCCAGG + Intergenic
990906308 5:60807002-60807024 CTCTGCTCCCGACCCTTTCCTGG - Intronic
991925675 5:71703034-71703056 CTGGGTTCCCTCCCCTCTCCAGG - Intergenic
992982339 5:82188701-82188723 CTGTGTTCCATTTCCCCTCCAGG - Intronic
993628087 5:90250207-90250229 CTGTCGTCTCTTCCCTCTCAAGG + Intergenic
994476074 5:100271618-100271640 AAGTGCTCCCTTTCCTCTCATGG - Intergenic
995532625 5:113106411-113106433 CTATGCTCCATTCACACTCCTGG + Intronic
996026060 5:118647279-118647301 CTATGCTCCCCTCACTCCCCTGG + Intergenic
996815299 5:127567242-127567264 CTGTCAGCCCTTTCCTCTCCAGG - Intergenic
997369755 5:133351078-133351100 CTGTGCCGCTTTCCCTCTGCTGG - Intronic
997468374 5:134103026-134103048 CTGTCCTCCCTCCCCTCTGAGGG + Intergenic
997830657 5:137146850-137146872 CTCTGCTCTCTGCCCTATCCAGG - Intronic
998043989 5:138971704-138971726 CTGAGTTTCCCTCCCTCTCCAGG - Intronic
998136933 5:139678850-139678872 CTGTCCTCCCACCCCTCTCTTGG + Intronic
998899097 5:146833311-146833333 CTGTGCTCCTTTCCTTCTCATGG + Intronic
999964855 5:156798388-156798410 CTGTGCCCCCTCCCCTTTCCAGG - Intergenic
1000050757 5:157561267-157561289 CTGTGTTCCCCCTCCTCTCCTGG + Intronic
1000193129 5:158932059-158932081 GTGTGCTCCCTCCCCTCCCACGG - Intronic
1001144124 5:169169180-169169202 ATGTGCTCCGTTCCCTGTCCTGG + Intronic
1001234058 5:170014665-170014687 CTCTTCTTCCTTCCCTCTCCTGG - Intronic
1001937012 5:175712490-175712512 CTGAGCTCCATTCCCTCATCTGG - Intergenic
1002106125 5:176880186-176880208 CTCTCCTCCCGTCCCTCTCCAGG + Exonic
1002310272 5:178309812-178309834 CTGTGCTCGATTCTCCCTCCTGG + Intronic
1002451269 5:179320126-179320148 GTGGCCTCCCTTCCCTCACCAGG - Intronic
1002632715 5:180591646-180591668 CCGTGCCCCCTTCCCTGCCCGGG + Intergenic
1002640007 5:180626265-180626287 CTGACCTCCCTTCCCTGGCCAGG - Exonic
1002978644 6:2111943-2111965 CTGTGTTCCCTCACCTCTCCAGG - Intronic
1003114344 6:3273412-3273434 CTGTGCTTCCCTCCCCCTGCAGG - Exonic
1003463187 6:6351468-6351490 CTGTTCTCCCCTGCCTCCCCTGG - Intergenic
1003810732 6:9777055-9777077 CTGTCCCCCTTTCTCTCTCCAGG + Intronic
1004546504 6:16603374-16603396 CTGGGCCACCTTCCCTTTCCAGG + Intronic
1005866976 6:29944005-29944027 CTGTGCTCTCTTCCCCATCCCGG + Intronic
1005987623 6:30884376-30884398 CAGCCCTCCCTTCCCCCTCCCGG - Intronic
1006332617 6:33403287-33403309 CTTTGCTCTCTCCCATCTCCTGG + Intronic
1006539387 6:34727196-34727218 GGGTCCTCCCTTCCCTCTCAAGG + Intergenic
1006743744 6:36326851-36326873 CTCTGCTGCCTCCCCTCTCTCGG - Intronic
1006933185 6:37699498-37699520 CTCTCCTCCCTTGACTCTCCAGG + Intergenic
1008896303 6:56559895-56559917 CTGTGCTCCCTTCTCCTTCATGG - Intronic
1009952670 6:70414148-70414170 CTGTGCTTCCATCCCTTGCCTGG + Intronic
1011662293 6:89604938-89604960 CCCTGCACCCTTCCTTCTCCGGG + Intronic
1012638371 6:101577824-101577846 CTTTGGTCCCTTCTCTCTCAAGG - Intronic
1015398740 6:132764560-132764582 CTCTACTCCTTTCCCTCTCTGGG + Intergenic
1015934835 6:138398457-138398479 CAGTGCTCTCTTCCCTTGCCAGG + Intergenic
1016079593 6:139839630-139839652 CTGTGCTTCCTTCCCTTTTTAGG + Intergenic
1016800565 6:148164822-148164844 CTGTGCTACCTCCACACTCCCGG + Intergenic
1016809512 6:148245912-148245934 CTGGGCTCACCTCCATCTCCCGG - Intergenic
1018396616 6:163382746-163382768 TGGTGCTCCCTTCCCCCTCAAGG + Intergenic
1019319624 7:409689-409711 CTGTCCTCTTTTCCATCTCCGGG + Intergenic
1019328893 7:453053-453075 CCGTGCTCTCACCCCTCTCCAGG + Intergenic
1019527950 7:1489255-1489277 CTGTGTTCCCTGCTGTCTCCTGG - Intronic
1019531019 7:1503608-1503630 CTGTGCTGCCTCCCGCCTCCTGG + Intronic
1019747166 7:2707450-2707472 CTCTGCCCCCTTCCCTCCCTGGG + Intronic
1020338126 7:7080303-7080325 CTTTGCCCTCTTCACTCTCCAGG - Intergenic
1022037246 7:26546122-26546144 CTGTCCTACCTTCCATCTTCTGG + Intergenic
1022114986 7:27253222-27253244 CTGTGCTCCCATCTCCCTCCAGG - Intergenic
1022141518 7:27497059-27497081 CTGTATTTCCTTCCCTCTTCAGG + Intergenic
1022212572 7:28225802-28225824 CATTGCTCCCTCCCCTTTCCAGG - Intergenic
1023347427 7:39285820-39285842 CTCTGCTTTCTTCCCACTCCTGG + Intronic
1024211757 7:47212284-47212306 CTGTGCTTCCTTCCTCCTCCAGG + Intergenic
1024473531 7:49787836-49787858 CTGGGCTCCCAGTCCTCTCCAGG + Intronic
1026904666 7:74056249-74056271 CTTGGCTCCCTTCCCTCTGCAGG + Exonic
1026931142 7:74223632-74223654 CTGTCCTGCCTTCCCTTTGCAGG - Intronic
1027186268 7:75972570-75972592 CCGGGCTGCGTTCCCTCTCCTGG - Intronic
1027278933 7:76591381-76591403 CTTTGCTCCTTTCCCAGTCCTGG - Intergenic
1029129982 7:98322550-98322572 CTGTGGTCTCTTCCCTGCCCAGG + Intronic
1029149672 7:98470861-98470883 CCGTGCTTCCGTCCCTCTGCAGG + Intergenic
1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG + Intronic
1029505986 7:100964586-100964608 CTCTGCTCCCTTCCCCCTTCTGG + Intronic
1029668359 7:102010563-102010585 CTCTACTTCCTTCCCTTTCCCGG - Intronic
1029744906 7:102511426-102511448 CTGAGCTCCCTTCCCCTCCCTGG - Intronic
1029762898 7:102610588-102610610 CTGAGCTCCCTTCCCCTCCCTGG - Intronic
1030086075 7:105816794-105816816 CCGTGCTCCCTGCACTCTGCAGG - Intronic
1030642524 7:112022446-112022468 CTGTGCCTGCTTCCCTCTCAAGG - Intronic
1032086576 7:128886902-128886924 CTCTGCCCCCACCCCTCTCCAGG - Exonic
1032148498 7:129406356-129406378 GTGTGCTCTCTCCCCTCTTCAGG + Exonic
1033458874 7:141527497-141527519 CTGTGCTCCTTTCCACCTCAGGG + Intergenic
1034197754 7:149261573-149261595 CTGGGGTCCCTTCCTCCTCCCGG - Intergenic
1034467117 7:151236449-151236471 CCGAGCTCCCTTCCTTCTCAGGG - Exonic
1035277949 7:157759149-157759171 CGCTCCCCCCTTCCCTCTCCTGG + Intronic
1035750462 8:1992416-1992438 CCGAGCTCGCTCCCCTCTCCTGG - Intronic
1036153505 8:6320495-6320517 CTCTGCACCCTTGACTCTCCTGG - Intergenic
1036635681 8:10548347-10548369 CTCTGCTTCCCTCCCCCTCCAGG - Intronic
1037605876 8:20436719-20436741 CTCTGCTCCATTCACTCACCAGG - Intergenic
1039445649 8:37629807-37629829 CTATGTTCCCATCCCTTTCCAGG - Intergenic
1039848372 8:41342273-41342295 CTCTGCTCCCCTCCCTCTGAGGG + Intergenic
1041850743 8:62389082-62389104 CAGCTCTCCCTTCCCTCTCCAGG - Intronic
1043516875 8:81002937-81002959 CTGCCTTCCCTGCCCTCTCCAGG - Intronic
1043874430 8:85468243-85468265 CTGTGCTCTCTTAAGTCTCCTGG - Intronic
1044753225 8:95436258-95436280 CTGTGCACCATTCCGTATCCTGG - Intergenic
1044861168 8:96525351-96525373 CTGTGCTCACTTCCACCTGCAGG + Intronic
1045349430 8:101324595-101324617 ATGTGCTCTCTTCCCTCTCTTGG + Intergenic
1045551503 8:103176907-103176929 CTGTGCTACCTCCCCTTTGCTGG + Intronic
1045640095 8:104240038-104240060 ATGTGGCCCCTTCCCTCTTCAGG + Intronic
1047401624 8:124553329-124553351 CTGTGCTCCCCCCGCTCTTCTGG + Exonic
1048257685 8:132917583-132917605 CTGTGCTCCAAGGCCTCTCCTGG - Intronic
1048287383 8:133152322-133152344 CTTTTCTCCCTTCCCTCCTCAGG - Intergenic
1048330254 8:133466190-133466212 CTGTTCACCCTTCTCTCTGCTGG + Intronic
1048544581 8:135374582-135374604 CTGGGCTCGCTCCCCTCACCAGG + Intergenic
1048765727 8:137842438-137842460 CTGTTCACCCTGCCCTGTCCTGG - Intergenic
1048965860 8:139614057-139614079 CCTTGCTCACCTCCCTCTCCTGG + Intronic
1049048178 8:140169588-140169610 CAGTGCTTCCTTCCTTCTCGTGG - Intronic
1049250015 8:141583168-141583190 CAGTCCTCCCGTCCCGCTCCAGG - Intergenic
1049320114 8:141991795-141991817 CTCTGCTGTCTTCTCTCTCCAGG + Intergenic
1049447856 8:142639684-142639706 CTGTCCTCCCTTTTCTCTGCTGG - Intergenic
1049463491 8:142740638-142740660 CTGAGCTTCCTTCCCTCTCTAGG + Intergenic
1049488606 8:142879270-142879292 CTGTCCACCCTCCCCTCTCCTGG + Intronic
1050839801 9:10134265-10134287 CTGTGCTCCCTTCTCCCTTGGGG - Intronic
1051374945 9:16393198-16393220 CTGTGCCCCTTTCCCGCTGCCGG - Intergenic
1052580486 9:30349019-30349041 CTGTGCTCAGTTCGCTCTACTGG + Intergenic
1052819711 9:33129127-33129149 CTGTGGAGCCTTCCCTCTGCAGG + Intronic
1053148398 9:35727564-35727586 CTCTGCCCCCTCCCCACTCCTGG + Intronic
1053200442 9:36148447-36148469 CTGAGCTTCCTTCCCTGCCCCGG - Intronic
1053258699 9:36641975-36641997 CTGAGCTCCCTTCCAGGTCCAGG + Intronic
1053488931 9:38485446-38485468 CTGAACTCCCTGCCCACTCCTGG + Intergenic
1054337066 9:63817038-63817060 CTGTTCTACCCTCCCTCCCCTGG + Intergenic
1055123147 9:72686204-72686226 CTATCCTCCCATCACTCTCCAGG + Intronic
1056241847 9:84655545-84655567 CTGTTCCTCCTTCCCTCTCCCGG - Intergenic
1056839697 9:89988389-89988411 CCCTGCTCCCTTCCCCCTCAAGG + Intergenic
1056992496 9:91424202-91424224 CTTGGCTCCCTTCACCCTCCCGG + Intergenic
1057140349 9:92722944-92722966 CTGGGCTCCCTCTCCTCTCCAGG - Intronic
1057311288 9:93944919-93944941 CTGGGCTCCCTTCAGGCTCCAGG + Intergenic
1057669280 9:97074732-97074754 CTGAACTCCCTGCCCACTCCTGG + Intergenic
1057847898 9:98539513-98539535 CTTTGTCCCCTTCCCTCTCTGGG + Intronic
1058272190 9:102986309-102986331 TGGTGCTCCCTCCCTTCTCCTGG - Intergenic
1058869333 9:109188925-109188947 CCGTGCTAGCTTCCCTCCCCAGG - Intronic
1060406402 9:123375195-123375217 CTCAGCCCCCCTCCCTCTCCAGG + Exonic
1061014498 9:127974068-127974090 CTGTGCCCCCATCCATCTCCCGG + Intronic
1061570621 9:131475612-131475634 AGGTGCTCTCCTCCCTCTCCAGG - Exonic
1061790277 9:133055491-133055513 CTGTGCGGCCTTCCTTCTCGAGG + Intronic
1061960693 9:133987528-133987550 CTGTGCTCCCTGCCTCTTCCCGG - Intronic
1062019011 9:134307455-134307477 CTGTGCCCCTTTTCCTCTCAGGG - Intergenic
1062253166 9:135608463-135608485 CCGTGGTTCCTGCCCTCTCCAGG - Intergenic
1062280799 9:135750820-135750842 CTGGGCTCCCCTCCCACACCCGG - Intronic
1062540597 9:137040155-137040177 CTGTGCTCCCCTGCCACCCCAGG - Intronic
1062579575 9:137223334-137223356 CTGGGCTCCCGGCCCTCCCCAGG - Intergenic
1062605956 9:137348965-137348987 CTTTGCTCCCCTCTCGCTCCAGG + Intronic
1062622263 9:137428429-137428451 CTGTGCCCCCAGCCCTTTCCTGG + Intronic
1186072441 X:5836877-5836899 CTGAGCTCCCTTCCTTTTCATGG + Intergenic
1186463123 X:9764425-9764447 CTGAAATCCCTTCCCTATCCAGG - Intronic
1187002975 X:15201052-15201074 CTGGGCTCCCTTCCCTCAACGGG - Intergenic
1189516770 X:41720335-41720357 CTGAGCCCCCTGCCCTCTCCAGG - Intronic
1189740489 X:44112692-44112714 CTGAGCTCCCTTTCATCTCAAGG + Intergenic
1190261569 X:48801007-48801029 CTGTGCTCCGTTTCCTCATCTGG - Intergenic
1190599749 X:52078257-52078279 CTGTGCTTTCTTCCTGCTCCTGG - Intergenic
1190641665 X:52486106-52486128 CTGTGCTTCCTGGTCTCTCCAGG + Intergenic
1190646007 X:52526759-52526781 CTGTGCTTCCTGGTCTCTCCAGG - Intergenic
1190980580 X:55453914-55453936 CAGTGCTCCCTCCCCTATGCTGG - Intergenic
1190988117 X:55519266-55519288 CAGTGCTCCCTCCCCTATGCTGG + Intergenic
1192363930 X:70455524-70455546 CTGTGCCCCCTTCTCACCCCAGG + Intronic
1197883549 X:131193949-131193971 TTGTGGTCCCTTCCATCTCCAGG + Intergenic
1198442160 X:136673666-136673688 CTGCCCTCACTTTCCTCTCCTGG + Intronic
1199487291 X:148362148-148362170 CCATGCTCCCTTCCCTCTCAAGG - Intergenic
1199609406 X:149600168-149600190 CTGTGTTCTCTCCCCTCTCCTGG + Intronic
1199629711 X:149769186-149769208 CTGTGTTCTCTCCCCTCTCCTGG - Intergenic
1199990871 X:152987283-152987305 CTGTTCTCCCTGCCTTCTTCAGG - Intergenic
1200033960 X:153316757-153316779 CTGTTCTCCCTGCCTTCTTCAGG - Intergenic
1200066047 X:153504511-153504533 CTGCGTTCCCATCCCTCACCAGG - Intronic
1202386624 Y:24332797-24332819 TGGTGCTCCCTGCTCTCTCCAGG + Intergenic
1202484161 Y:25337331-25337353 TGGTGCTCCCTGCTCTCTCCAGG - Intergenic