ID: 1029372453

View in Genome Browser
Species Human (GRCh38)
Location 7:100158301-100158323
Sequence CACCGGGGGCGGCCCGGGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029372453_1029372462 -2 Left 1029372453 7:100158301-100158323 CCAAGCCCGGGCCGCCCCCGGTG 0: 1
1: 0
2: 2
3: 29
4: 289
Right 1029372462 7:100158322-100158344 TGCCGGACCCCGCACCGCCCCGG 0: 1
1: 0
2: 1
3: 12
4: 139
1029372453_1029372471 22 Left 1029372453 7:100158301-100158323 CCAAGCCCGGGCCGCCCCCGGTG 0: 1
1: 0
2: 2
3: 29
4: 289
Right 1029372471 7:100158346-100158368 AGCGCAACACCAGCAGAAAACGG 0: 1
1: 0
2: 0
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029372453 Original CRISPR CACCGGGGGCGGCCCGGGCT TGG (reversed) Exonic
900622281 1:3592959-3592981 TCCCCGGGGCAGCCCGGGCTGGG - Intronic
900663090 1:3795837-3795859 CAGCGGGGGCTGCCCGGGCGGGG - Intronic
901415048 1:9110852-9110874 CCCCTGGGGCAGCCCGGCCTTGG + Intronic
901627285 1:10631454-10631476 GAGCGGGGGCGGCCCGGGCCTGG - Intergenic
901934564 1:12618570-12618592 GCCCGCGGGCGGCCCGGGCAAGG - Intergenic
902612194 1:17603769-17603791 CACCGGGGCCGGGCAGGGCTTGG + Intronic
903063469 1:20685541-20685563 CAGCCGGGGCAGCCCTGGCTAGG - Intronic
903193524 1:21669265-21669287 GGCCGGGGGCGTCCTGGGCTCGG + Intronic
904162252 1:28530622-28530644 CACAGAGGGCGCCCCGGGCGCGG - Intronic
904500132 1:30908544-30908566 CCCCGTGGGCGGCCCCGGCACGG + Exonic
905647198 1:39633019-39633041 CCCCGGGGGCGGGGCGGGCGAGG + Intronic
906053954 1:42899891-42899913 CACCAGGTGCGGGCAGGGCTAGG + Intergenic
906062566 1:42958257-42958279 CACCGGGAGGGGCCGAGGCTGGG + Intronic
906640472 1:47438075-47438097 CTCCGGCAGCGGCTCGGGCTCGG - Exonic
906678306 1:47708850-47708872 CACCCGGGTCGGCAAGGGCTGGG + Intergenic
907430242 1:54406954-54406976 GCCCGGGGGCGGGGCGGGCTGGG - Intronic
911548839 1:99255080-99255102 CACCGCGCCCGGCCTGGGCTGGG - Intergenic
911664756 1:100539760-100539782 CAGCGCGGGCGGCAGGGGCTGGG - Exonic
912381322 1:109249662-109249684 CGCCGGGGCCGGGCCGGGGTCGG + Intergenic
913450196 1:118987872-118987894 CACCGGGCCCGGCCCGGGAGAGG + Intronic
914847082 1:151289277-151289299 GCCCGGGGGAGGGCCGGGCTGGG + Intronic
915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG + Exonic
919463246 1:197902942-197902964 CGCCGCGGCCGCCCCGGGCTCGG + Intronic
920145482 1:203857714-203857736 CACCGTGCCCGGCCCAGGCTTGG + Intergenic
922729411 1:227942073-227942095 CTGCTGGGGTGGCCCGGGCTGGG - Intronic
922768087 1:228166270-228166292 CACCCGGGGAGGGCCGGGATGGG + Intronic
923884357 1:238138476-238138498 CACAGGGGACAGCCCGGACTTGG - Intergenic
924446623 1:244138654-244138676 GACCGTGGGCTGCCCGGGCCTGG + Intergenic
1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG + Intronic
1067474224 10:46555897-46555919 CAGCAGGGGCGGCCTGTGCTTGG - Intergenic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1070923855 10:80205401-80205423 CTCCGCGGGCGTCCCGGGCGCGG + Exonic
1073196432 10:101695136-101695158 CGGCGGTGGCGGCTCGGGCTGGG - Exonic
1073347569 10:102795622-102795644 CACCAGAGGCAGCCCAGGCTCGG - Intronic
1073432286 10:103494269-103494291 CACCGGGGGAGGGCCCTGCTGGG - Exonic
1075645465 10:124093337-124093359 CGCCGGCGGCGGCCGGGGCTGGG - Intronic
1076366091 10:129921903-129921925 GACAGGGGGCGGGCCAGGCTTGG - Intronic
1076792514 10:132784857-132784879 ATCCGGGGGCGGCCCCGGGTGGG - Exonic
1076986146 11:237090-237112 CACAGCGGGCTGCCCGGGCCCGG - Exonic
1077144054 11:1036980-1037002 CAGCGGGGAGGGCCCGGGCCAGG - Intergenic
1077308471 11:1878227-1878249 CACAGAGGGCGGCGCAGGCTGGG - Intronic
1077341381 11:2027893-2027915 TGCAGGGGGCGGCCCGGGCCAGG - Intergenic
1080606548 11:33869310-33869332 CACCGGGGGTGGCAGGGGCAGGG + Intronic
1081995414 11:47360537-47360559 CACCGCGCGCGGCCCTGGCTGGG - Intronic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1082805509 11:57446939-57446961 CACCGCGCCCGGCCAGGGCTGGG + Intergenic
1083332520 11:61905519-61905541 CAGCGGGGCCAGCCCGGGCTGGG + Intronic
1084129201 11:67119793-67119815 AGGCGGGGGCGCCCCGGGCTCGG + Exonic
1084153002 11:67299882-67299904 CACCGGGGTGAGCCGGGGCTGGG + Exonic
1084336607 11:68461203-68461225 GACCGGGCGCGGGCCGGGCGGGG - Intronic
1084633378 11:70372266-70372288 TACTGGGGGAGGCCCAGGCTGGG - Exonic
1084784074 11:71431513-71431535 CACCGAGGGCCGACTGGGCTTGG - Intronic
1089432651 11:118436557-118436579 CACCGGGGGCGGCGGCGGCGGGG + Exonic
1202824366 11_KI270721v1_random:83082-83104 TGCAGGGGGCGGCCCGGGCCAGG - Intergenic
1095349062 12:41188373-41188395 CCCCGGGGGTGGCCCGGGGAAGG + Intergenic
1095476277 12:42589910-42589932 CCCCGGGCGCGGCCCGAGCCGGG - Intronic
1096435897 12:51591078-51591100 GGCCGGGGCCGGCCCGGGCAGGG + Intronic
1099365127 12:81758864-81758886 CACCCCGGGTGGCCCGGGCGCGG - Intronic
1102151018 12:110689175-110689197 GGGCGGGGGCGGCCCGGGCGGGG - Intronic
1102457171 12:113077964-113077986 CCCGGGAGGCGGCGCGGGCTCGG - Exonic
1102997347 12:117360815-117360837 TCCCGCGGGCAGCCCGGGCTGGG - Intronic
1103348359 12:120265778-120265800 CACAGGGGGCGGCCGGGGGCGGG - Intergenic
1103527655 12:121578769-121578791 CGCAGAGGGCGGCCCGGGGTGGG + Intronic
1105405319 13:20128176-20128198 CAGCGGGGCCGGCCAGGGCCCGG + Intergenic
1105768063 13:23579873-23579895 CGCCGGGGCCGGGTCGGGCTTGG - Intronic
1106248005 13:27965117-27965139 CACCCTGGGGGGCCCGGGTTTGG + Intronic
1110318643 13:74135705-74135727 CACGCGGGGCGGGCCGGGCCGGG - Intergenic
1112050707 13:95642052-95642074 CCCGGGAGGCGGCCCAGGCTGGG - Exonic
1113312045 13:109141011-109141033 CGCGGGGGGCGGCCCGGGCGGGG - Exonic
1113853163 13:113429338-113429360 AACTGGGGGCGGCCAGGGCCTGG - Intronic
1114269221 14:21091016-21091038 CTCCGGGGGTGGCCCGGGGCCGG + Exonic
1115046398 14:29000284-29000306 CACCGGGGACTGCCAGGGCAGGG + Intergenic
1117803197 14:59465262-59465284 CACCGGGGGCGGCGGCCGCTAGG + Exonic
1119326120 14:73760389-73760411 CTCAGGCGGCGGCCGGGGCTGGG + Intronic
1122745327 14:103894303-103894325 CTCCTTGGCCGGCCCGGGCTGGG + Intergenic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1123025029 14:105420253-105420275 CATCGGGGGCGGGCGGGGCTCGG + Intronic
1124392188 15:29269477-29269499 CGGCGGGGGCGGCCTGGGCCCGG + Exonic
1124427019 15:29570864-29570886 CGCCGGGAGCGGGCCGGGCCGGG + Intergenic
1124453615 15:29821781-29821803 CACTGGGGGCGGCCGGGGAGGGG - Intronic
1126084226 15:44996158-44996180 CACCGGGGCCTGTCAGGGCTTGG + Intergenic
1126668424 15:51094700-51094722 CGGCGCGGGCGGCGCGGGCTGGG + Intronic
1128322255 15:66702093-66702115 CTCCCGGGGCGGGCCGAGCTCGG - Intergenic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1129162242 15:73753221-73753243 GGCCGGGGGCGGCCGGGGCGCGG - Intergenic
1129738613 15:77979112-77979134 CAGTGGGAGCGGCCCAGGCTTGG - Intergenic
1130040748 15:80404065-80404087 GTGCGGGGGCAGCCCGGGCTAGG + Intergenic
1130370881 15:83284578-83284600 GACGCGGGGCGGCCCGGGCCCGG - Exonic
1132478535 16:154215-154237 CGCCGGGCGGGGCCCGGGCTAGG + Intronic
1132480714 16:164971-164993 CGCGGGGCGGGGCCCGGGCTAGG + Intronic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132934900 16:2475240-2475262 CACCGCGGTCGGCGCGTGCTGGG + Intronic
1132994748 16:2817201-2817223 CCCAGGGGGCGCCCCGGGCCCGG + Intronic
1133038397 16:3046888-3046910 CCCCGCCGGCGGCCCGGGCTGGG + Exonic
1135189880 16:20346140-20346162 CACAGGGGCCATCCCGGGCTGGG + Exonic
1135429852 16:22374174-22374196 CAGCGGGGGCCTCCCGGGCCAGG + Intronic
1135479925 16:22814079-22814101 CCCTGGGCGCGGCGCGGGCTCGG + Intergenic
1136365371 16:29806905-29806927 CGGCCGCGGCGGCCCGGGCTGGG + Intronic
1136570668 16:31094699-31094721 CACCTGGGGGAGCCCTGGCTGGG - Exonic
1139750410 16:69106368-69106390 CACCCGGCGCGCCCCGGCCTCGG - Intronic
1140223125 16:73058220-73058242 AGGAGGGGGCGGCCCGGGCTCGG + Intronic
1141463379 16:84191460-84191482 AACTGGGGGCAGCCCGGGCGTGG + Exonic
1141518573 16:84562697-84562719 CCCAGGGTGCGGCCCTGGCTGGG - Intergenic
1141644157 16:85358470-85358492 CACCAGGGGCGGGCTGGGCTGGG - Intronic
1142156492 16:88534777-88534799 CGGCGGGGGCGGCACGGCCTCGG - Exonic
1142184985 16:88690586-88690608 AACCAGGGGCTGCCCAGGCTGGG - Intergenic
1142336098 16:89490356-89490378 CGGCGGCGGCGGCGCGGGCTCGG + Exonic
1203139658 16_KI270728v1_random:1753238-1753260 GACCTGGGGTGGTCCGGGCTGGG + Intergenic
1144211970 17:13023429-13023451 AACCTGGGGCGACTCGGGCTGGG - Intergenic
1144269025 17:13600506-13600528 GAGCGGGGCGGGCCCGGGCTGGG - Intronic
1146492356 17:33292138-33292160 CAGCGGCGGCGGCCCCGGCCGGG + Exonic
1147285687 17:39401408-39401430 CGGCGGGTGCGGCCCGGGCCGGG + Exonic
1147382174 17:40062680-40062702 CTGCGGGAGCCGCCCGGGCTGGG + Intronic
1147429449 17:40362718-40362740 CACCTGGGGCAGGCCGGGCTGGG - Intronic
1148090263 17:45019100-45019122 CGGCGCGGGCGGCCCGGGCGGGG + Intergenic
1148110929 17:45144385-45144407 AACCAAGGGTGGCCCGGGCTGGG + Intergenic
1148715134 17:49710633-49710655 CACCTGGGGCTGGGCGGGCTGGG + Exonic
1148929955 17:51120294-51120316 CTCCGGGGGCGGCCGGGGCGGGG - Intronic
1150408026 17:64919319-64919341 CAGTGGGGGCGGCCGGGGCCGGG + Intronic
1152225265 17:79089967-79089989 CACCGTGGGCGCCCAGGGCCAGG - Intronic
1152238225 17:79149384-79149406 CACCAGGAGGGGCCGGGGCTGGG - Intronic
1152345535 17:79748481-79748503 CACCGCCGGCGGCCCAGGCGCGG - Intergenic
1152523751 17:80875818-80875840 CATCCTGGGCGGCACGGGCTCGG - Intronic
1152523771 17:80875915-80875937 CATCCTGGGCGGCACGGGCTCGG - Intronic
1152523791 17:80876012-80876034 CATCCTGGGCGGCACGGGCTCGG - Intronic
1152524015 17:80877028-80877050 CATCCTGGGCGGCACGGGCTCGG - Intronic
1152617046 17:81342822-81342844 CTCCCGAGGCGGCCCCGGCTCGG - Intergenic
1152798746 17:82321568-82321590 CGGCGGCGGCGGCTCGGGCTGGG - Exonic
1152898747 17:82928232-82928254 CACCGTTGGAGGCCCAGGCTGGG - Intronic
1152925827 17:83087369-83087391 CACCGGGGGCCCCCGGAGCTGGG + Intronic
1154214870 18:12408307-12408329 GAGCGGGGGCGGCCGGGGCGGGG + Intronic
1155152744 18:23135667-23135689 GAGCGGCGGCGACCCGGGCTGGG - Intronic
1155170062 18:23260540-23260562 CACGGGAGGCAGCCAGGGCTGGG - Intronic
1156448498 18:37253742-37253764 AACCGGGGGCGGCCGGGGCGCGG - Intronic
1157665959 18:49487131-49487153 CTGCGAGCGCGGCCCGGGCTGGG + Intronic
1160453250 18:78979490-78979512 CCCCGGCGGCCGGCCGGGCTCGG - Intergenic
1160453694 18:78980964-78980986 CAGCGGCGGCGGCCTGGGCCTGG + Intronic
1160779043 19:869691-869713 CTCCGGGGAAGGCCCCGGCTCGG - Intronic
1160792644 19:929639-929661 CGTCGGGGGCAGCCCGGGCCCGG - Exonic
1160921839 19:1524272-1524294 CGACGGGGCCGGACCGGGCTGGG + Intronic
1160995818 19:1881578-1881600 CCCCGGTGGAGGCCCGGCCTGGG - Exonic
1161006882 19:1941462-1941484 CACTGGGGGCGCCCAGGGCCAGG - Intronic
1161108766 19:2456902-2456924 TCCCGACGGCGGCCCGGGCTCGG + Exonic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1161377276 19:3946425-3946447 CACCCGGGGCTGCCTGGTCTCGG - Intergenic
1161393989 19:4035103-4035125 CGCCTGGGGCGGCCCTGGCACGG + Intronic
1161767707 19:6216346-6216368 CACCCGGGGCGACTCCGGCTGGG - Intronic
1161802631 19:6424545-6424567 CGGCGGCGGCGGCCCGGGCGGGG - Exonic
1162125662 19:8498422-8498444 CCCCGGGGGCAGCGGGGGCTTGG + Exonic
1162470916 19:10871639-10871661 CAGCGGCGGCGGCCTGGGCCCGG + Exonic
1162880626 19:13656233-13656255 CACCGTGCCCGGCCGGGGCTAGG + Intergenic
1162954713 19:14091370-14091392 CGGCGGGGGCGGCCCTGGCAGGG - Intergenic
1163666680 19:18606854-18606876 CCCCGGGGCCGGGCCGGGCCGGG - Intronic
1163803971 19:19385317-19385339 CACCGGAGGCGGCCTTGGCCAGG - Intergenic
1163862234 19:19748484-19748506 GGCCGGGGGAGGCCCGGGCAGGG - Intergenic
1164638981 19:29811553-29811575 CACGGCGGGCGGCGCGGGTTCGG - Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165452128 19:35889900-35889922 CACCTGCTGCGGCCCGGGCCGGG - Exonic
1165913737 19:39245346-39245368 CACCAGGGGAGCCCCAGGCTGGG + Intergenic
1165917224 19:39268278-39268300 CACCAGGGGAGCCCCAGGCTGGG - Intergenic
1166215317 19:41330991-41331013 CAGCGGGGGCGGGGCGGGGTGGG + Exonic
1167046103 19:47049665-47049687 CACCGTGCCTGGCCCGGGCTTGG - Intergenic
1168154526 19:54465353-54465375 CGCGGGGGGCGCCCGGGGCTCGG + Exonic
925912653 2:8583551-8583573 CCCCGGGGGGTGCCCGGGGTTGG - Intergenic
926437637 2:12854170-12854192 CACCGCGGGGGGCTCGGGCATGG + Intergenic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927888174 2:26731077-26731099 GTCCGGGGGCTGCCCGGGGTGGG - Exonic
931671949 2:64654658-64654680 CTTCGGGGCCGGCCGGGGCTCGG + Intronic
932714819 2:74093447-74093469 CACCTGGGGAGGCCAGGTCTTGG - Intronic
933772601 2:85753819-85753841 CGGCTCGGGCGGCCCGGGCTGGG + Intronic
933772898 2:85755062-85755084 CACCAGGGTCGGACCGGGCGGGG - Intronic
936368596 2:111883856-111883878 CACCAGGGGAGGCTCGGCCTCGG + Intronic
937913371 2:127087189-127087211 CTCCAGGGGCCGGCCGGGCTGGG - Intronic
938727371 2:134120410-134120432 CACCGGGGTCGGCGCGGTCGGGG + Intronic
939179603 2:138788744-138788766 CACTGGGGCCTGCCCGGGCTGGG - Intergenic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942463824 2:176188455-176188477 GACCGGGGGCTGCCTGGGCAAGG - Intergenic
943820286 2:192313964-192313986 CACCTGGGGCTGCCCACGCTAGG - Intergenic
944586957 2:201181041-201181063 CACAGGGGGAGCCCCAGGCTGGG + Intergenic
945386616 2:209209332-209209354 CAGCTGGGGCAGCCCGGGCCGGG + Intergenic
946231287 2:218292514-218292536 CTCCGGGGCCGGGCAGGGCTAGG + Intronic
947669254 2:231926160-231926182 CTTCGGCGGCGCCCCGGGCTTGG + Exonic
947871735 2:233442469-233442491 CACCTGGGGAGGCCGTGGCTTGG - Intronic
948492233 2:238320865-238320887 CGCCGGGTGCGAGCCGGGCTCGG + Intronic
948492268 2:238320946-238320968 AACCGGGTGTGGGCCGGGCTCGG + Intronic
948513241 2:238487307-238487329 CACTGGGGGCGGCCTTGGCAAGG + Intergenic
948850443 2:240702913-240702935 GACAGGGGGCGGCCTGGGCTTGG - Intergenic
1172277320 20:33686627-33686649 CAGCAGGGGACGCCCGGGCTGGG - Intergenic
1172433826 20:34914357-34914379 CACCTGGGGCGGGCAGAGCTCGG + Exonic
1172764831 20:37345928-37345950 ACCCAGGGGCGGCCCGAGCTGGG - Intronic
1173525012 20:43725338-43725360 CACCGGGCCCGGCCTGGACTTGG + Intergenic
1174836797 20:53863635-53863657 GACCTGGGGTGGTCCGGGCTGGG + Intergenic
1175199117 20:57266158-57266180 CACCTGGGGCGGTGCGGGCCCGG - Exonic
1175399652 20:58693094-58693116 CTCCGCGGGCCGCCCGGGCCTGG - Intronic
1175776756 20:61658664-61658686 CACCAGCTGGGGCCCGGGCTTGG + Intronic
1175998326 20:62821193-62821215 CCCCCGGGGCCGCCCGGGCTGGG + Exonic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1178372636 21:32038831-32038853 CACCGGGGCCTGCCAGGGCATGG - Intronic
1179435479 21:41359518-41359540 CACCGGTGGGGGACTGGGCTGGG - Intergenic
1179511956 21:41879199-41879221 CAGCGGGTGCGGCCCGGGGCCGG + Intronic
1179522405 21:41953831-41953853 CGGCGGCCGCGGCCCGGGCTGGG + Exonic
1179630230 21:42673347-42673369 CACCTGGGCAGGCCTGGGCTTGG - Intronic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180699696 22:17774523-17774545 CGCCGGGGGCGGGCCGGGGCGGG - Intronic
1181064549 22:20299369-20299391 CACCGGAGCCGGCCGGGCCTCGG + Intergenic
1181811240 22:25405035-25405057 CCCCGGGGATGGCCCGGGCAGGG + Intronic
1182763502 22:32741983-32742005 CACCGCGCCCGGCCAGGGCTTGG - Intronic
1183240388 22:36653472-36653494 GACCGGGGGCTGCCCGGGCTGGG + Intronic
1183586468 22:38755800-38755822 CCCCGGCGGCGGCCTGGCCTCGG - Exonic
1184557444 22:45240937-45240959 GACCGGGGCCGGGCCGGGCCGGG - Intergenic
1184680700 22:46071081-46071103 CGGCGGGGGCGGGCCGGGCCGGG + Intronic
1184769395 22:46588779-46588801 CACTGGCGTCGGTCCGGGCTGGG + Intronic
1184807288 22:46803298-46803320 AACCGGGGTCACCCCGGGCTGGG + Intronic
1185233190 22:49694887-49694909 CAGCAGGGGTGGCCAGGGCTGGG + Intergenic
1185298856 22:50068609-50068631 CAGCGGGCGTGGCCAGGGCTGGG + Intronic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950726179 3:14918500-14918522 CACCTGGGGTTGCCCGGGCTGGG + Intronic
950815739 3:15700282-15700304 CACCGGGGCCTGTCCGGGGTGGG + Intronic
951080462 3:18445279-18445301 CGGCGGCGGCGGCTCGGGCTCGG - Intronic
951475767 3:23104082-23104104 CAGCTGGGGCTGCCTGGGCTTGG - Intergenic
952416728 3:33096819-33096841 CGTCGGGGGCGGGCCGGGCGGGG - Intronic
953884080 3:46705806-46705828 CAGCGGAGGCGGCTTGGGCTTGG - Exonic
954912545 3:54121928-54121950 CACGCGGGGCGGATCGGGCTGGG - Intergenic
959637237 3:108589378-108589400 CACCGGCCGCGGCCCGGCTTAGG + Exonic
961010114 3:123429945-123429967 CAGCGGGGGCAGCTCGGCCTGGG + Intronic
961518952 3:127455959-127455981 TCCCGGGGGCGGCCCGGCATGGG + Intergenic
961574457 3:127823231-127823253 CGGCGGGGGCGGCCCGAGGTGGG + Intronic
961821213 3:129576561-129576583 AACCGGGGACGGTCAGGGCTCGG + Intronic
963038325 3:141051229-141051251 CGCCGGCAGCGGCCCGAGCTGGG + Intergenic
966696427 3:182793976-182793998 CAGCCTCGGCGGCCCGGGCTTGG - Intronic
968504077 4:963984-964006 CACAGGGGCCGGCCGTGGCTGGG + Intronic
969534184 4:7745927-7745949 CTCCGGGGGGGTCCCAGGCTGGG + Intergenic
976629351 4:87220615-87220637 CTCTGGGGGCGGGGCGGGCTGGG + Intronic
979033149 4:115678437-115678459 CACCTAGGGCGTCCCGCGCTGGG + Intergenic
981280626 4:142954533-142954555 CACCGCGGGGGGCTCGGGCATGG - Intergenic
986813664 5:11385173-11385195 CGGCGGCGGCGGCGCGGGCTCGG + Exonic
989178731 5:38556248-38556270 CCCCAGGGGCGGCCCGGGCGGGG - Intronic
990049683 5:51482298-51482320 CACCGGGGCCTGTCCGGGCATGG + Intergenic
990381879 5:55227169-55227191 CGGAGGCGGCGGCCCGGGCTGGG + Exonic
992365372 5:76084435-76084457 CGCGGGGAGCGCCCCGGGCTGGG + Intronic
992828122 5:80569647-80569669 CAGCGGGAGCGGCGCGCGCTGGG - Intronic
994210743 5:97085319-97085341 CACCGCGGGGGGCTCGGGCATGG + Intergenic
997470482 5:134114641-134114663 CACTGGGGGCGGGCCGGGCCGGG - Intergenic
997990961 5:138543894-138543916 CAGCGGGGGCTGCCTGAGCTTGG + Intergenic
999279728 5:150357473-150357495 CCCCGGGGCCGGCCGGGACTTGG - Intergenic
1001065110 5:168529675-168529697 CGGCGGGGGCGGCCGGGGCCGGG + Exonic
1002091834 5:176810649-176810671 CCCCGGGGGCGCCCCGAGCTGGG + Exonic
1003868717 6:10385111-10385133 GACCGGAGGGGGCGCGGGCTGGG - Intergenic
1006318414 6:33304585-33304607 CCCCTGGGGCGGCCCGTGCAAGG + Exonic
1006671479 6:35732083-35732105 GACCGGGGGAGGCCCGGGACGGG + Intergenic
1007409542 6:41653882-41653904 CGCAGGGGGCAGCCAGGGCTGGG + Exonic
1013369096 6:109455042-109455064 CACAGGGGGCGGGGCGGGGTAGG - Intronic
1013793689 6:113860434-113860456 CTCCGGGGGCGCGCCGGGCCCGG - Exonic
1016992718 6:149941232-149941254 CACCGCGCCTGGCCCGGGCTAGG - Intergenic
1018890509 6:167978254-167978276 CAGCGCGGGCGGCCGGGGCGAGG + Intergenic
1019395817 7:816989-817011 CGCGGCGGGCGGCCCGGGCTGGG + Intronic
1020083161 7:5297121-5297143 CACCGGGGCAGGCCAGGCCTGGG + Exonic
1020268473 7:6577615-6577637 CACCGGGGCCGCCCCGGACTCGG - Exonic
1020584832 7:10053308-10053330 CACTGGGGGCTGCTCGGGGTGGG + Intergenic
1021433569 7:20588849-20588871 CACCTGGGAGGCCCCGGGCTGGG - Intergenic
1022094496 7:27130371-27130393 CGCCGGGGGCTGCTCGGGCTGGG + Exonic
1025502685 7:61324509-61324531 CACCGGGGACTGCTGGGGCTGGG + Intergenic
1025517555 7:61670731-61670753 CACCGGGGACTGCTGGGGCTGGG + Intergenic
1025541878 7:62099381-62099403 CACCGGGGACTGCTGGGGCTGGG + Intergenic
1026825314 7:73578157-73578179 CCCCGGGGACGGCCTGGCCTCGG + Intronic
1027654985 7:80919238-80919260 CCGCGGGGGCGGACCGGGCGGGG + Exonic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1032125157 7:129188486-129188508 CGCCTGGAGGGGCCCGGGCTAGG - Intergenic
1035314878 7:157991503-157991525 CACCGGGTGCTGCCCGTGCAGGG + Intronic
1036952452 8:13154188-13154210 CACCTGGTGCGGCCCTGGCACGG - Intronic
1038176343 8:25184719-25184741 GACCGCGGGCGGCGCGGGCACGG + Intronic
1038963521 8:32548138-32548160 CACCGGGAGGAGCCTGGGCTCGG - Intronic
1039476405 8:37841460-37841482 CACCCGGGGCAGCCAGCGCTGGG - Exonic
1039785614 8:40832054-40832076 CACAGGGGTCAGCCCTGGCTTGG - Intronic
1042020612 8:64369540-64369562 CTGCGGGGCCGCCCCGGGCTCGG - Intergenic
1044343154 8:91070679-91070701 CCCCGGCGGCGGCGCGGGGTAGG - Intronic
1049318944 8:141985694-141985716 CACTGGAGGCAGCCAGGGCTGGG - Intergenic
1049413486 8:142484391-142484413 TGCCGGGTGCTGCCCGGGCTAGG - Intronic
1049665530 8:143841084-143841106 GCCTGGGCGCGGCCCGGGCTCGG - Intergenic
1049709280 8:144056391-144056413 CACCCGGGGAGGCCCGGTCTGGG + Exonic
1049788525 8:144462612-144462634 CGGCGGGGGCGGCCCGGCCGCGG - Intronic
1053013103 9:34646610-34646632 CATCGGGGGCGGCGCGGGGAGGG + Intronic
1053129243 9:35605703-35605725 CACGGGCGGAGGCCCGGGCCGGG + Exonic
1057232903 9:93335621-93335643 CCCAGGGGGCGCCCCGGGCCAGG - Exonic
1057252609 9:93516000-93516022 CCCAGGGGGCGCCCCGGGCCAGG + Exonic
1058063573 9:100524896-100524918 CACCGGGGCCTGCCAGGGGTGGG - Intronic
1058866653 9:109167177-109167199 CAGCGGGGGCGCCGCGGGCGCGG + Exonic
1060209014 9:121699201-121699223 GGCCGAGGGCGGGCCGGGCTCGG - Intronic
1060700620 9:125746975-125746997 CCCCCGGGGCCGCCGGGGCTCGG + Intergenic
1061113384 9:128591636-128591658 CACTGGGGGCCGCAAGGGCTAGG + Intronic
1061448375 9:130654977-130654999 GACCAGGGGCTGCCAGGGCTGGG + Intergenic
1061843804 9:133375814-133375836 GTCAGGGGGCGGCCCGGGCCTGG + Intronic
1061861708 9:133471805-133471827 CACTGTGGGCTGCCTGGGCTGGG + Exonic
1062038726 9:134394551-134394573 CTCTGGGGGAGGCCCGGGCAGGG + Intronic
1062412651 9:136432761-136432783 CACCGAGGGCGTGCCGTGCTGGG - Intronic
1062452610 9:136621874-136621896 CACCTGCGGCGGCCGGCGCTGGG - Intergenic
1062582063 9:137233160-137233182 CAGGTGGGGGGGCCCGGGCTGGG - Intronic
1062610509 9:137371418-137371440 CATCGGGGGCTGCCCTGGCCGGG - Intronic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1185643141 X:1599463-1599485 CACTGAGGGCAGCCCGGGCGCGG - Intronic
1185751013 X:2609513-2609535 CGCGGGGGGTGGCGCGGGCTGGG + Intergenic
1187281470 X:17861005-17861027 CGCAGGGGGCGCGCCGGGCTGGG - Intronic
1187396964 X:18927299-18927321 CACCGGGGACAACCCGGGATCGG + Intronic
1188896910 X:35680185-35680207 CACCGGGGCCTGCCGGGGGTTGG - Intergenic
1189281205 X:39821221-39821243 CCCCGGGCGCCGCTCGGGCTAGG + Intergenic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1195285236 X:103376912-103376934 CAGCGAGGGGAGCCCGGGCTCGG + Intronic
1195470011 X:105220175-105220197 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1195732659 X:107981905-107981927 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1198215532 X:134550919-134550941 CCCCGGGGGCGGTGCGGGGTGGG + Intergenic
1198312721 X:135437023-135437045 CAGCGGGCGCGTCCCGGGCAGGG - Intergenic
1198370579 X:135985453-135985475 CACCGGCGGCCGCCCGCGGTCGG - Exonic
1200787547 Y:7273748-7273770 CCCCGGGGGCGCCCCGGGCGCGG + Intergenic
1202368640 Y:24183073-24183095 CTCTGGGGGTGGCCGGGGCTGGG - Intergenic
1202502145 Y:25487044-25487066 CTCTGGGGGTGGCCGGGGCTGGG + Intergenic