ID: 1029375746

View in Genome Browser
Species Human (GRCh38)
Location 7:100176105-100176127
Sequence GAGTCTTCACAGATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029375732_1029375746 21 Left 1029375732 7:100176061-100176083 CCCTGGAGACAGAGTCTGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 418
Right 1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
1029375734_1029375746 20 Left 1029375734 7:100176062-100176084 CCTGGAGACAGAGTCTGGGGGGT 0: 1
1: 0
2: 3
3: 19
4: 348
Right 1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG 0: 1
1: 0
2: 1
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029375746 Original CRISPR GAGTCTTCACAGATGGAGTA AGG Intronic
903166357 1:21523413-21523435 GAGTCTTTACAGAAGGAGGCAGG - Intronic
905363842 1:37438187-37438209 GAGACTTCCCAGAGGGAGCAAGG - Intergenic
905449975 1:38049830-38049852 GAGGCTCCACAGATGAAATAAGG + Intergenic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
907492459 1:54816882-54816904 AACTCATAACAGATGGAGTAGGG + Intronic
907898632 1:58717368-58717390 GAATCTTCACTGATGCAGTGAGG - Intergenic
907965342 1:59323429-59323451 GATTCTCCTCAGATGGAGTATGG + Intronic
908953679 1:69594615-69594637 AAGTCTGTACGGATGGAGTATGG - Intronic
912314195 1:108651812-108651834 GAGCCATCATAGATGGAGTTGGG - Intronic
914688421 1:150003445-150003467 GAGTCTTGAAAGATGAATTAAGG - Intronic
916211781 1:162365591-162365613 GAGCCTTCACAGAGGAAGCAGGG - Intronic
919088084 1:192945406-192945428 GCGTTTTCACAGATGTAGTAGGG - Intergenic
921181517 1:212635520-212635542 CAGTCTTCAGAGATGGATGAGGG + Intergenic
923125095 1:231027781-231027803 GAGCATTCACAGATGCAGTGGGG - Intronic
924518486 1:244785776-244785798 GAGTATTAACAAGTGGAGTATGG - Intergenic
924528840 1:244876336-244876358 GAGTCTTCAAAGAGTGAGCAGGG + Intergenic
1063956456 10:11272001-11272023 GAGTCCTCAAAGAGGCAGTATGG - Intronic
1065609405 10:27457161-27457183 TAGTCTTTACAGAAGGAGCAGGG + Intergenic
1066396001 10:35022342-35022364 GAGTCTTCACAAATGGTTGATGG - Intronic
1066647744 10:37627016-37627038 GAGTATTCAAAGAGGGAGTCCGG - Intergenic
1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG + Intronic
1068746989 10:60543850-60543872 GAGTCTGGACAGATTGACTAGGG - Intronic
1072758223 10:98035229-98035251 GAGCCATCACAGATGCAGAAAGG + Intergenic
1074351302 10:112739510-112739532 GAGACTTAACAGATGAAATATGG + Intronic
1077514745 11:2994662-2994684 GAGTCTTCACAGATGCAATTAGG + Intergenic
1078018406 11:7635035-7635057 GAGTCTGGAAAGATGGAGGAGGG + Intronic
1078551688 11:12285624-12285646 GCATTTTCACAAATGGAGTAAGG + Intronic
1078663603 11:13306556-13306578 GAGGCTTCACAGAGGAAGTCTGG + Intronic
1080444253 11:32323172-32323194 TAATCTTCACAGATGGATTATGG + Intergenic
1080712211 11:34759609-34759631 GATTGTTTAGAGATGGAGTAGGG + Intergenic
1081807288 11:45897421-45897443 GAGGCTGCACAGATGGGGTCAGG - Intronic
1083868566 11:65472178-65472200 GTGGCTTCAGAGATGGAGTGGGG - Intergenic
1087175761 11:95093398-95093420 GAGTCTTAAAGGATGGAGTAAGG - Intronic
1087611427 11:100438588-100438610 GAATGTTCACATTTGGAGTATGG + Intergenic
1088565640 11:111169816-111169838 GACTCTTGAAAGATGGAGGAGGG - Intergenic
1088698765 11:112392850-112392872 AAGTCTTCACATTTGGAGGAGGG + Intergenic
1099317959 12:81108011-81108033 GAGTCTCCACTCATGGAGGAAGG + Intronic
1104361277 12:128135521-128135543 GATTTTTCACAGATGAAGCAGGG - Intergenic
1105655492 13:22432937-22432959 GAGTATTTACAGACAGAGTAAGG - Intergenic
1108067846 13:46597094-46597116 GAGTCCTCACGGATGGATTTGGG - Intronic
1110166204 13:72446567-72446589 GAGTTTTCATAGATGAAATAAGG - Intergenic
1110959256 13:81599908-81599930 GAGTCTTCCCAGAGGGAATTTGG - Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1113667971 13:112154074-112154096 GAAGCTTCTCAGATGGAGAAAGG - Intergenic
1116491867 14:45513781-45513803 GATTGTTCACTGTTGGAGTATGG - Intergenic
1116845163 14:49858592-49858614 GACTATTCACAGATAGAGAAGGG - Intergenic
1117884306 14:60343609-60343631 GGATCTTCACAGATGGAGATGGG - Intergenic
1123150296 14:106175023-106175045 GAGTGTTCATAAATGGAGCAGGG - Intergenic
1127988689 15:64095332-64095354 GAGGCCTCACAGATGAAGTGAGG - Intronic
1128592232 15:68910283-68910305 TATTCTTCACAGATGCAGTCTGG - Intronic
1129279605 15:74473870-74473892 GAGTATTCTCACATGGACTAAGG + Intergenic
1132062566 15:98704451-98704473 GAGTCTTGTCAGATGGTGTTGGG + Intronic
1134451847 16:14368535-14368557 TATTCTTTACAGATGGGGTAAGG - Intergenic
1137586038 16:49664502-49664524 GATTCTACAGAGATGGAGGAGGG + Intronic
1139516324 16:67454414-67454436 GAGCATTCAGAGATGGGGTAAGG + Intronic
1143171409 17:4932650-4932672 GAGACCTCACAGATGGGGTGGGG - Exonic
1144359843 17:14481615-14481637 GAGGCTTCACAGAGGAAGTAGGG - Intergenic
1146569906 17:33943321-33943343 GAGTTTTCAAAGATGAAGTGCGG - Intronic
1148858361 17:50591364-50591386 GAGTCCTCTCCGAGGGAGTAGGG + Intronic
1150770503 17:68036692-68036714 AAGATTTCAAAGATGGAGTATGG + Intronic
1152431839 17:80252657-80252679 GAGTCTTCTCTGATGTTGTAGGG - Exonic
1152477114 17:80525651-80525673 GAGACTTCACGGATGGAATTAGG - Intergenic
1157257813 18:46154037-46154059 GAGAATTCAAAGATGGAGGAAGG + Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1164955750 19:32382494-32382516 GAGACTTCAAAGAAGGAGGATGG - Exonic
1165967591 19:39596171-39596193 GAGTCATCTGAGATTGAGTAAGG - Intergenic
1165978291 19:39696610-39696632 GAGTCATCTGAGATTGAGTAAGG - Intergenic
1168504767 19:56924050-56924072 AAGTCTTCTCTGATGGTGTAAGG - Intergenic
928392021 2:30917509-30917531 GAGTATTGACAGATGGGGTAAGG - Intronic
930081068 2:47449207-47449229 GATTCTTCAGATCTGGAGTAGGG + Intronic
933176685 2:79181432-79181454 TAGTCTTCAAAGAGGGACTATGG + Intergenic
935016038 2:99182978-99183000 GAGTGTTGACAGTTGGGGTATGG + Intronic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
936451942 2:112640442-112640464 GAGTTTTCAGGGAGGGAGTAGGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
941266972 2:163374533-163374555 AAGCCAACACAGATGGAGTAGGG + Intergenic
942145766 2:173024702-173024724 AAGTCTACACAGTTAGAGTAGGG + Intronic
944141703 2:196463959-196463981 GAGTTTTCATAGGTGGAGGAAGG - Intronic
946499182 2:220227432-220227454 GAGTCTTTTCAGATTTAGTAGGG + Intergenic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
1171793059 20:29546176-29546198 GAGTCTTCACAAATGGGTTTAGG + Intergenic
1172202747 20:33138420-33138442 GGATTCTCACAGATGGAGTAGGG - Intergenic
1173013122 20:39200413-39200435 GAGTGGCCACTGATGGAGTACGG + Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173585877 20:44182660-44182682 GAGTCGTCTCAGAAGGAGGATGG - Intronic
1185409828 22:50676029-50676051 AAGACTTCACAGCTGGAGAAAGG - Intergenic
950043444 3:9934377-9934399 GAGGCTTCACTGAAGGAGTCAGG - Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
957218379 3:77350605-77350627 GAGTCTTAACAGAAGGTGTCAGG + Intronic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
959108925 3:102098383-102098405 GAGCTTTCACAGAGGTAGTATGG + Intergenic
961190186 3:124953774-124953796 GAGTCCTCTCAGAAGGGGTAAGG - Intronic
961408318 3:126699129-126699151 GATTCTTCACAGTGGGAGTGAGG + Intergenic
963798048 3:149650725-149650747 GACACTTCTCAGATGGAGTTGGG + Intronic
964641699 3:158915653-158915675 GGGTCTTCACATTTGGAGTAGGG - Intergenic
964984221 3:162719117-162719139 AAGTCTTCTCAGTTGGTGTAAGG + Intergenic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
969210662 4:5684767-5684789 GGGTCTTTACAGAGGTAGTAAGG + Intronic
970974332 4:22025570-22025592 CAGTCTTTAAAGATGGATTAAGG + Intergenic
972145207 4:36015586-36015608 GATTCTTCACATATGGTATATGG + Intronic
978014834 4:103730323-103730345 GAGTCATCAAAAATGGAGTAGGG + Intergenic
978631208 4:110747488-110747510 GGGTGTTCACAGTTGGAGAATGG + Intergenic
979195614 4:117916888-117916910 GAGACTTCACACAGGGAGTGGGG + Intergenic
979682894 4:123481012-123481034 GAGTCTTCTCATTTGGAGTTGGG + Intergenic
981541896 4:145854604-145854626 GAGTGCTCAGAGATGAAGTAGGG - Intronic
990785469 5:59413789-59413811 GAGTCTTCATAGATAAAATAGGG + Intronic
993218217 5:85053626-85053648 GAGTTTTCACAAATGGCCTAGGG + Intergenic
994537434 5:101049343-101049365 GAGTCTTGACTGACTGAGTAGGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
997299531 5:132792445-132792467 GACCCTTCACAGATGGATGAGGG - Intronic
1000816025 5:165922883-165922905 GAGTCTTTACACGTGGAGAAGGG + Intergenic
1005316344 6:24606324-24606346 GAGGCTTCTCAGATGGCCTAGGG - Intronic
1008202454 6:48607823-48607845 GAATCTTCAGAGATAGAGAAGGG + Intergenic
1013200838 6:107894381-107894403 GAATCATCACAGGTGGAGCATGG + Intronic
1014110088 6:117610627-117610649 GAGTTTTCACACATTGACTAAGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1018538265 6:164847607-164847629 AAGTATTCACAGTTGAAGTAAGG - Intergenic
1018803331 6:167239917-167239939 TAGTCATCACTGATGGAGTTTGG + Intergenic
1019353117 7:564376-564398 GAGTCCTCCCAGAGGGAGCAAGG - Intronic
1020736382 7:11954059-11954081 GAGTTTTAAGAGTTGGAGTAGGG + Intergenic
1024288949 7:47786431-47786453 CAGTCTTCACAGATTGTGTTGGG + Intronic
1026453021 7:70545843-70545865 GAGCCTTCATAGAAGGAGTGGGG + Intronic
1028508815 7:91599136-91599158 GGGACTTCACAGCTAGAGTAAGG + Intergenic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1032120997 7:129156418-129156440 CAGTCTGCACTGAAGGAGTAAGG + Intronic
1034045514 7:147923224-147923246 GAGTCTTTACAGATGTACTCAGG + Intronic
1034737854 7:153445785-153445807 GATTCATCACAGATGGAATGAGG + Intergenic
1036387389 8:8294331-8294353 GAGTCCTGAAAGGTGGAGTATGG - Intergenic
1038482500 8:27911335-27911357 GAGTCTTCACAGCAGGTATAGGG - Intronic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1039883809 8:41644314-41644336 GCATCTTCACAGATGGAGGGTGG + Intergenic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1045970950 8:108079676-108079698 GATTATTCGCAGATGGAATATGG + Intronic
1047028548 8:120851147-120851169 GAGCCTTCATGGATGGGGTAAGG + Intergenic
1047362549 8:124182512-124182534 GAGTCTTCACTGCTGGTCTAAGG + Intergenic
1049280648 8:141742456-141742478 GAGTCTTAAAAGATGAAGTGGGG + Intergenic
1051848218 9:21476967-21476989 GACTCTTCACAGGTGGAGTAAGG + Intergenic
1052665702 9:31492472-31492494 GAGTCTTGACAGAAGCAGTTTGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1057319093 9:93995774-93995796 GAGTCTTCTCATTTGGGGTAAGG - Intergenic
1058595627 9:106612368-106612390 GAGCCTGCAAAGATGGAGAATGG - Intergenic
1058836183 9:108860266-108860288 GAGTCTTCCAAGATGGAGGAAGG + Intergenic
1059286292 9:113174674-113174696 GAGTTTTCAGAAATGGAGTAAGG - Intronic
1060730335 9:126033171-126033193 AAGTCTTCACAAGTGGCGTATGG + Intergenic
1061144795 9:128791361-128791383 GAATCTGCACAGAGGGAGAAGGG - Exonic
1061932031 9:133838256-133838278 AAGTCTTCCCACATGCAGTAGGG - Intronic
1192538978 X:71952351-71952373 GAGTGTTTACAGTTGGAGAAGGG + Intergenic
1200250081 X:154547969-154547991 GAGTCCTCACACAAGGAGTAGGG - Intronic