ID: 1029379552

View in Genome Browser
Species Human (GRCh38)
Location 7:100204101-100204123
Sequence CCTGCTGCTGAGCCTCAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029379548_1029379552 -2 Left 1029379548 7:100204080-100204102 CCGAAGTCATTGTTCCCGAATCC 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1029379552 7:100204101-100204123 CCTGCTGCTGAGCCTCAAGCAGG 0: 1
1: 0
2: 2
3: 32
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029379552 Original CRISPR CCTGCTGCTGAGCCTCAAGC AGG Exonic
900186014 1:1333624-1333646 CCTGCTGCTGAGCCTGGCGCTGG + Exonic
901055359 1:6446601-6446623 CCTGCTCCAGAGCCTCAGCCAGG - Intronic
902333952 1:15744279-15744301 CCTGCTGCTGAGCCTCGGGCTGG + Exonic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902479007 1:16701988-16702010 CCTGCTCCAGAGCCTCAGCCAGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
903154421 1:21434441-21434463 CCTGCAGCTGCTCCTCCAGCTGG - Intergenic
903213652 1:21831699-21831721 CCTGCTGCGCAGCCTCACCCAGG - Exonic
903779863 1:25814295-25814317 CTGGCTGCAAAGCCTCAAGCTGG + Intronic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
904442358 1:30540004-30540026 CCGGCTGCAGAGCCTGAAGGTGG + Intergenic
904817584 1:33217060-33217082 CCTGATGCTGAGCTGGAAGCTGG - Intergenic
904882670 1:33712474-33712496 CCTGCTGCCGAGGCTCAGGCTGG - Intronic
904900804 1:33855618-33855640 CCAGCTGCTGAGGCTTTAGCTGG + Intronic
905923615 1:41734704-41734726 CCTGCTCCTGAGTCTCTGGCTGG - Intronic
905967959 1:42115382-42115404 CCTGCAGCTTACCCTCTAGCAGG + Intergenic
908124951 1:61021435-61021457 CTCTCTCCTGAGCCTCAAGCAGG - Intronic
910426434 1:87123773-87123795 CCTTCTGCAGAGGCTCCAGCAGG - Intronic
911110036 1:94174086-94174108 ACTGCTGCTGAGGGTGAAGCTGG + Exonic
912491491 1:110065071-110065093 CTGCCTGCTGAGCCTCCAGCTGG + Intronic
912527472 1:110294494-110294516 CCTGATGCTGTCCCTCAGGCAGG - Intergenic
912624884 1:111198712-111198734 CCTCCTGCTGACCCCGAAGCAGG + Exonic
913220959 1:116660023-116660045 ACTGCTGCTGAGCCCCAGCCTGG - Intronic
913673162 1:121116921-121116943 CCTGCTGCTGCCCGGCAAGCTGG - Intergenic
914196996 1:145452736-145452758 CCTGCTCCTGAGCCTGGGGCTGG - Intergenic
916321679 1:163511944-163511966 CATCCTGCTCTGCCTCAAGCTGG - Intergenic
916494033 1:165328571-165328593 CATGCTGCTGTGCCTCCAGCAGG - Intronic
919675446 1:200377830-200377852 CCAGGTGCAGTGCCTCAAGCCGG + Intergenic
920003342 1:202814189-202814211 CCTGCTGCGGAGGCTGAGGCAGG + Intergenic
920417936 1:205811253-205811275 GCTCCTGCTGAGCCTCCAGATGG - Intronic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
923429964 1:233910393-233910415 CCTGCAGCAGAGCCTCTATCTGG - Intronic
924724631 1:246657700-246657722 GCTCCTGCTCAGCCTCAACCAGG - Intronic
1063344248 10:5296387-5296409 CCTGTTGCAGAGCCTCAGGTTGG + Intergenic
1063732374 10:8712596-8712618 CAAGCTGCTGAGCCTCCATCTGG - Intergenic
1066697261 10:38090573-38090595 CCTGAAGCTGAGTCTCCAGCAGG - Intergenic
1067227562 10:44385616-44385638 CCGGCGGCTGCGCCGCAAGCCGG - Intronic
1067753322 10:48985896-48985918 CCTGCTTCTGGGCCCCAGGCAGG - Intergenic
1067941250 10:50659104-50659126 TCCACTGCTCAGCCTCAAGCTGG - Intergenic
1068127574 10:52860034-52860056 CCTAATGCTGAGCCTAATGCTGG + Intergenic
1069621678 10:69841105-69841127 CCTGCTCCTAAGCCCCAGGCTGG - Intronic
1069881996 10:71598933-71598955 TCTGGGGCTGAGCCTCCAGCTGG + Intronic
1070559298 10:77553714-77553736 CCTGCTGCTGACCTTGAACCTGG - Intronic
1070615886 10:77968840-77968862 CCTGAAGCTGAGCCCCAAGACGG - Intergenic
1070862473 10:79683976-79683998 TCCACTGCTCAGCCTCAAGCTGG - Intergenic
1071287666 10:84163748-84163770 CCTGCTGCTGAGGTCAAAGCTGG - Intergenic
1071399650 10:85256855-85256877 CCTTCTGCAGAGCCCCAGGCAGG + Intergenic
1072225100 10:93361409-93361431 CCTGCTGCAGAGCCCCAATCAGG + Intronic
1072801684 10:98396688-98396710 CATGATGCTGAGCTCCAAGCAGG + Intronic
1074201773 10:111243862-111243884 CTTGCGCCTGAGCCTCAAGGAGG - Intergenic
1077171587 11:1168700-1168722 CCTGCAGCTGAACCTGCAGCTGG + Exonic
1077360114 11:2137122-2137144 CCTGCTGCCCTGCCTCAGGCTGG + Intronic
1079395208 11:20056273-20056295 CCGGTGGCTGAGCCTCAAGGTGG - Intronic
1080752523 11:35164082-35164104 TCTACTGCTGAGCCCCCAGCTGG - Intronic
1081853335 11:46289057-46289079 CCCTCTGCAGAGCCTCAAACAGG - Intronic
1082267798 11:50138459-50138481 CCTGACCCTGTGCCTCAAGCAGG - Intergenic
1083271451 11:61574934-61574956 CCTCGTGCAGAGCCTCATGCAGG + Intronic
1083540926 11:63511084-63511106 CCTGCTGATGAGCCCCAGGCTGG + Exonic
1083782807 11:64926734-64926756 CGAGCTGCTGAGCCGGAAGCTGG + Exonic
1083998907 11:66285445-66285467 CCTGCTCCTGGGCCTCTACCTGG - Exonic
1084688538 11:70711395-70711417 CAGGCTGCTGAGCCAAAAGCGGG + Intronic
1088173177 11:107019142-107019164 ACTGTTGCTGAGCCTCAGCCGGG + Intergenic
1089665874 11:120018610-120018632 CATGCTACTGAGTCTCAAGAGGG - Intergenic
1089760273 11:120717862-120717884 CCAGCTGCTCAGCCTCCAGGAGG - Intronic
1090418221 11:126555616-126555638 CTTCCTGCTGCTCCTCAAGCAGG - Intronic
1090953616 11:131495755-131495777 CCTTCTGCTGAGCCTCAAGGAGG - Intronic
1101604789 12:106239833-106239855 CGAGCTGGTGAGCCTCAAGCAGG - Exonic
1102418844 12:112788041-112788063 CCTGCTGCAGTGCCACAGGCTGG + Intronic
1103808604 12:123594509-123594531 GCTGCTTCTGAGCCTGAGGCAGG + Intronic
1103937340 12:124483541-124483563 CCAGCAGCAGAACCTCAAGCGGG + Intronic
1104508595 12:129355900-129355922 CCTGCTCCTGTGCCTCTAGCTGG + Intronic
1104880657 12:132068312-132068334 CCTGGTGCTTATCCTCAAGACGG + Intronic
1104963345 12:132498392-132498414 CCTGTAGCTCAGCCTCCAGCCGG - Intronic
1105502837 13:20988195-20988217 CCTGCTGCTGCGCAGCAAGTCGG - Exonic
1105923331 13:24984901-24984923 CCGGCCTCTGAGCCTCAGGCTGG - Intergenic
1106376700 13:29195923-29195945 CCTGCTGTGGAGCCTGAAGCAGG + Intronic
1108562333 13:51657725-51657747 CCTGCTGTTGAGCCTCATTATGG + Intronic
1111583461 13:90253790-90253812 CCTGCTGCTCTGCCTGAGGCTGG + Intergenic
1113055411 13:106261898-106261920 CCTGCTGCTGAGCTTCAGGTTGG - Intergenic
1114670469 14:24408231-24408253 GCTGCTGCTGAGCCTGGTGCGGG + Exonic
1118613210 14:67557391-67557413 TCTCCAGCTGAGCCTCTAGCTGG - Exonic
1119857852 14:77914115-77914137 ATTACTGCTGAGCCTCAAGCAGG - Intronic
1120849641 14:89158282-89158304 CCTGATGCTGTCCCTCAGGCAGG + Exonic
1123124680 14:105937896-105937918 CCTGCTGCTGCACATCCAGCTGG + Intergenic
1124964661 15:34424027-34424049 TCTGCTGCTTGGCCTCAGGCAGG - Intronic
1124981278 15:34570253-34570275 TCTGCTGCTTGGCCTCAGGCAGG - Intronic
1125824558 15:42665309-42665331 CCTGCTGCTGAGCTTTGAACTGG + Exonic
1125974127 15:43936220-43936242 TCTGTTGCTGAGGCTCAGGCTGG + Intronic
1126098563 15:45106196-45106218 CCTGCTGCAGAGGCTGCAGCTGG + Exonic
1126167078 15:45662792-45662814 CCTGCTGCTGAGCCCAGGGCAGG + Intronic
1126890146 15:53196407-53196429 GCTGCTGCTGTGCCTTTAGCTGG + Intergenic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1128345444 15:66850011-66850033 CCTGCTCCTCAGCCTCCAGTGGG + Intergenic
1128809733 15:70562096-70562118 CCTGCACCTGAGCCTGAAGCTGG + Intergenic
1129364553 15:75046361-75046383 GCTGCTGCTGACCCGCCAGCAGG - Intronic
1129975174 15:79815815-79815837 CCAGCTGCTGAGTCTCATGGAGG + Intergenic
1130518699 15:84645757-84645779 CCTTCTGCTGTGCTTCAGGCCGG - Exonic
1130705801 15:86232017-86232039 CCTGAGGCCGAGCCTCAGGCCGG + Intronic
1130792247 15:87167943-87167965 CCTGCAGCTGAGAGTCAAGCAGG - Intergenic
1131272053 15:90953488-90953510 CCTGCTTCTGAGCTCCAACCAGG + Exonic
1131394602 15:92076611-92076633 CATTCTGCTGAGCCTCACTCTGG + Intronic
1132179121 15:99738451-99738473 CCTGCTGTGCAGCCTCAGGCAGG - Intergenic
1132368667 15:101277444-101277466 CCTGCCGCCGCGCCTCCAGCCGG + Exonic
1132598745 16:764709-764731 CCTGCTGCTATTCCTCAAGTAGG + Exonic
1132799564 16:1745204-1745226 CCTGCTCCTGACCCTCATGGTGG - Intronic
1132806439 16:1777243-1777265 GCTGCCGCCGGGCCTCAAGCAGG - Exonic
1132861033 16:2071913-2071935 CCTGCTGCAGTGCTTGAAGCAGG + Exonic
1133287862 16:4698823-4698845 CCTGCATCTCAGCCTCCAGCCGG + Exonic
1133924436 16:10182042-10182064 CCTGCTGCAGAGCCTCCGGCTGG - Exonic
1135354354 16:21757168-21757190 GCAGCTGCAGAGCCTCCAGCAGG + Exonic
1135452845 16:22573308-22573330 GCAGCTGCAGAGCCTCCAGCAGG + Intergenic
1135562339 16:23486441-23486463 CCTGTTGCTGGGACCCAAGCTGG + Intronic
1137004267 16:35258368-35258390 CCTCCTGCTGTTCCTCCAGCTGG + Intergenic
1138336882 16:56260429-56260451 CCGGCTGCTGGGCCAGAAGCAGG + Intronic
1138519031 16:57560164-57560186 CCTGCTGTTCAGCATCAACCCGG + Intronic
1140130920 16:72160467-72160489 CCTGCTGATTTGCCTAAAGCTGG + Intronic
1141505024 16:84471345-84471367 GGTGCTGCTGAGCCCCAGGCTGG - Intergenic
1141532654 16:84657539-84657561 CCTGCTGCACCGCGTCAAGCCGG + Exonic
1142014953 16:87740438-87740460 CCTGCTCCAGAGCCTAATGCTGG + Intronic
1142227386 16:88884265-88884287 CCTGCTGCTGGGCCCCCACCGGG + Intronic
1142713138 17:1734149-1734171 CGTGCTGCGGGGCCTCAAGCTGG - Exonic
1142883223 17:2896902-2896924 CCTGCAGCAGAGACTCCAGCCGG + Intronic
1143323388 17:6082373-6082395 TCTGGTACTGAGCCTCCAGCCGG - Intronic
1145258109 17:21338623-21338645 CCTGCTTGTGAGCCTCAGGATGG + Intergenic
1145318524 17:21749383-21749405 CCTGCTTGTGAGCCTCAGGAGGG - Intergenic
1146399941 17:32494390-32494412 CCTGCTGCTGACCCTGCAGAGGG - Exonic
1146957666 17:36946244-36946266 CCTCCTGCTGCGCCTCCTGCGGG - Intergenic
1147266934 17:39240108-39240130 CCTGCAGGTGAGCCTGAAGCTGG + Intergenic
1147367040 17:39965895-39965917 CCTTCAGGTCAGCCTCAAGCGGG + Exonic
1147436937 17:40422244-40422266 GCTGCTGCAGAGGCTGAAGCAGG - Intergenic
1148034161 17:44645682-44645704 CATGCTGCTGAGCTATAAGCAGG + Intergenic
1148850857 17:50554429-50554451 CCAGCAGCAGACCCTCAAGCAGG + Exonic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150436133 17:65155681-65155703 CCAGCTGTGGAGTCTCAAGCTGG - Intronic
1151674400 17:75590136-75590158 CCTGGAGCTGAGCCTCCGGCCGG + Intergenic
1152447229 17:80352872-80352894 GCTGCTGCTCAGCCCTAAGCAGG - Intronic
1152801475 17:82332803-82332825 GCTGCTGCTGAGCCCAGAGCGGG - Intronic
1153314694 18:3710373-3710395 CCCTCTGCAGAGCCTGAAGCTGG - Intronic
1153839073 18:8990107-8990129 CCTGCTGAGGAACCTCATGCAGG - Intergenic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1159378666 18:67628452-67628474 GCTGCTCCTGAGGCTGAAGCAGG - Intergenic
1159700778 18:71623927-71623949 CCAGCTGCTGTGTCCCAAGCAGG - Intergenic
1160157142 18:76442580-76442602 CCTGCTGCGGAGCAGCAAGAAGG - Exonic
1160908951 19:1466031-1466053 CCCGCTGCTGCGGCTCAAGGCGG + Exonic
1161626949 19:5332669-5332691 CCTGCTGCTGGGCCTTGCGCAGG - Intronic
1161685068 19:5698505-5698527 CCTGCTTCTGGGCCTGAGGCTGG + Intronic
1161699331 19:5786419-5786441 ACTGCTGCTGTGCATGAAGCTGG + Intronic
1162062989 19:8108030-8108052 CCTGCTGCTCAGCCTCCAGGTGG + Intronic
1162752061 19:12834964-12834986 CCTGGGGCTGAGCCCCAAGGAGG - Intronic
1162785835 19:13034226-13034248 CCTTGAGCTGAGCCGCAAGCTGG - Intronic
1162955225 19:14093732-14093754 CCTGCTGCGGAACCTCCTGCAGG - Exonic
1164483489 19:28633878-28633900 CCATCTGCTGTGCCACAAGCTGG + Intergenic
1165377003 19:35449852-35449874 CCTCCTGCTGAGCCTGACGCTGG + Exonic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1168640168 19:58025872-58025894 CCTGCTCCCCAGCCTCAGGCTGG - Intergenic
1202713048 1_KI270714v1_random:27895-27917 CCTGCTCCAGAGCCTCAGCCAGG + Intergenic
925280431 2:2680728-2680750 CCTCCTTCTGGGACTCAAGCTGG - Intergenic
926975682 2:18514694-18514716 TCTGGTGCTGAGCCCCAGGCTGG - Intergenic
927362582 2:22253323-22253345 TCAGCTGCTGAGCCTCCTGCAGG + Intergenic
927991849 2:27453664-27453686 CTTCCTGCAGAGCCTCCAGCTGG + Exonic
930449080 2:51511339-51511361 CCTGCAGCAGAGCCTGCAGCAGG + Intergenic
932740921 2:74290726-74290748 GCTGCAGCAGAACCTCAAGCAGG + Intronic
932750883 2:74370987-74371009 CCTGCAGCGGCGCCTCAAGGAGG - Exonic
933573031 2:84035977-84035999 CCTGCTGCTCAGCAATAAGCAGG + Intergenic
933591179 2:84234165-84234187 CCTGCTGCACACCGTCAAGCCGG + Intergenic
934485250 2:94701890-94701912 GCTACTGCGGAGGCTCAAGCAGG + Intergenic
934520328 2:95016236-95016258 CCAGCTACTGAGTCTGAAGCAGG + Intergenic
934613678 2:95758431-95758453 CCTGCTCCTCAGCCTCACTCAGG - Intergenic
934840597 2:97621804-97621826 CCTGCTCCTCAGCCTCACTCAGG + Intergenic
935017974 2:99202185-99202207 CCTGCTGGAGTGCCTCATGCAGG + Intronic
937655196 2:124366907-124366929 CCTTCTGCTGAGCCTCTCTCTGG - Intronic
937859778 2:126698471-126698493 ACTGCTGCTGAGCCTGATTCTGG - Intergenic
938528845 2:132162810-132162832 CCTGCTGCTCAGCCGCATCCTGG - Intronic
939403684 2:141729059-141729081 ACAGCAGCTGAGCCTCAAACTGG + Intronic
939961062 2:148566513-148566535 CCTACTGCAGTGGCTCAAGCAGG - Intergenic
942869924 2:180722308-180722330 CCTTCTGCCGAGGCTGAAGCAGG - Intergenic
944234596 2:197430563-197430585 CCTGCTTGGGAGCCTCAGGCAGG - Intronic
945405883 2:209448322-209448344 CCTCCTGTTGACCCTAAAGCTGG + Intronic
945946155 2:215997912-215997934 CCTGCTGCTGAACCCCAATCTGG - Intronic
946153022 2:217789039-217789061 CCTTCTGCTGAGCCACACCCTGG + Intergenic
947436614 2:230078387-230078409 CCTGCTGCTGAGCATGGAGAGGG + Intergenic
948632019 2:239308336-239308358 CCTGTTGCTGAGTACCAAGCAGG - Intronic
948899446 2:240949006-240949028 CCAGCTGTTGGGCCTCAAGGAGG - Intronic
948942933 2:241204985-241205007 CCTGGTGCTGGGCCTCCAGATGG + Intronic
1171213064 20:23331695-23331717 CCTGCTCCAGAGCCCCCAGCGGG - Intergenic
1171448657 20:25221620-25221642 CCTGCATCTCAGCCCCAAGCTGG - Intronic
1172390013 20:34559742-34559764 CCTGCAGCTGAACCCCACGCAGG + Exonic
1172484686 20:35291187-35291209 TCTGCAGCTGGGCCTGAAGCAGG - Intronic
1172511528 20:35504252-35504274 CCTCCTGCAGAGCCTCAGCCCGG - Exonic
1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG + Intronic
1173031816 20:39367991-39368013 TCTGTTGCTGATCTTCAAGCAGG + Intergenic
1174943292 20:54956134-54956156 CCTGAGGCTGAGGCTCAGGCAGG - Intergenic
1175105651 20:56612971-56612993 CATGCTGCTCAGCCTCACTCAGG + Intergenic
1176100449 20:63362085-63362107 CCAGCTGCAGAGCCTGAGGCTGG - Intronic
1176113956 20:63422998-63423020 CCTGCTGCTGGCCCTGAGGCTGG - Intronic
1176241241 20:64076856-64076878 CCTGCTTCTCAGCCTCATGCGGG + Exonic
1176272043 20:64240403-64240425 CCTCCTGGAGAGCATCAAGCAGG + Exonic
1176448238 21:6840360-6840382 CGTGGTGCTGAGCCGCAAGCTGG + Intergenic
1176767661 21:13037102-13037124 CCTGCTGCTCAGCCGCATCCTGG + Intergenic
1176826408 21:13705382-13705404 CGTGGTGCTGAGCCGCAAGCTGG + Intergenic
1178830646 21:36053880-36053902 CCTACTGCTGGGCCTCCTGCAGG + Intronic
1179590728 21:42406170-42406192 CCTGATGCTGAACTTCCAGCTGG - Intronic
1179654470 21:42836903-42836925 CCCGCTGCTGAGCACGAAGCAGG - Intergenic
1180028648 21:45185258-45185280 CCTGCTGCTGCCCCTCACGGGGG - Intronic
1180822484 22:18840229-18840251 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1180880136 22:19197717-19197739 CCTGCTGCTGAGCAGACAGCAGG - Intronic
1181079082 22:20401801-20401823 CCTGATGCTGATGCTCACGCTGG - Intronic
1181190482 22:21135797-21135819 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1181208722 22:21274724-21274746 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1181457062 22:23065818-23065840 CCTACTCCTCAGCCTCCAGCAGG - Intronic
1182444572 22:30382642-30382664 CCTGCAGCGGAGCTTCAGGCCGG - Intronic
1182692804 22:32175751-32175773 CCTGCAGCAGAGACTCCAGCCGG + Intergenic
1183204325 22:36408167-36408189 CCTCCTGCTCTCCCTCAAGCAGG + Intergenic
1185096325 22:48808019-48808041 CATGCTGCTGAGACCCTAGCTGG - Intronic
1185111324 22:48901729-48901751 CCTTCTGCGGAGCCTCCCGCTGG - Intergenic
1185111586 22:48903039-48903061 CCTTCTGCGGAGCCTCCCGCTGG + Intergenic
1203218216 22_KI270731v1_random:20721-20743 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1203272623 22_KI270734v1_random:66134-66156 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
949544621 3:5061800-5061822 CCTGCAGCTGGGGCTCCAGCTGG + Intergenic
953546814 3:43869600-43869622 CTTTCTGCTGGGGCTCAAGCTGG + Intergenic
954327911 3:49873583-49873605 CCTGCTGCTTGGCCTCCAACCGG + Intergenic
957322501 3:78650397-78650419 ATTGCTGCTGAGCCACAGGCAGG + Intronic
961826459 3:129601717-129601739 CCTGTTGCTGAGCCTGACTCTGG + Intronic
962187974 3:133280127-133280149 CCTGCTGAGGAGTCTGAAGCAGG + Intronic
969068166 4:4507177-4507199 GCTGCTGCTGAGCATCAAGAGGG - Intronic
969452604 4:7283464-7283486 ACTGCTGCAGAGCCTCAGGGCGG + Intronic
973329900 4:48902487-48902509 CCTGCTGCTGTGACTCACCCTGG - Intronic
976622323 4:87141702-87141724 CCAGCTGCTGACCCTCCAGCCGG + Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
981187067 4:141816174-141816196 CCTGGTCCTGAGCCTCTAGAGGG + Intergenic
981615843 4:146642926-146642948 CTTGCTTCTGGGCCTCAACCAGG - Intergenic
983903833 4:173164978-173165000 CTTGCTTCTGAGCCCCCAGCTGG + Intergenic
985425690 4:189828344-189828366 TCTGCTGCAGAGCCACCAGCTGG + Intergenic
985654173 5:1121431-1121453 CCTGCAGCCGAGTCCCAAGCAGG + Intergenic
985668863 5:1196220-1196242 CCTGCTGCAGAGCCTGAGGCCGG - Intergenic
986567372 5:9128201-9128223 CATGCTTCTGAACCTCAAACAGG + Intronic
986910413 5:12548904-12548926 TCTGCTGCTGACCCTGAGGCTGG + Intergenic
990068854 5:51753339-51753361 CCAGCTACTGAGGCTGAAGCAGG + Intergenic
991565384 5:67999082-67999104 CTTCCTGCTGTGCCTCCAGCAGG - Intergenic
992231903 5:74671990-74672012 CCTGCTTCTGTGCCTCACACTGG + Intronic
993862278 5:93150539-93150561 CCTGCTGCTGTGGCTCATGTTGG - Intergenic
997391913 5:133524137-133524159 CCTCCTTCTGCCCCTCAAGCAGG - Intronic
997478522 5:134164205-134164227 CCAGCTACTGAGGCTGAAGCAGG + Intronic
997613255 5:135229766-135229788 CCTGCTGCTGTTCCTCCAGAGGG + Intronic
999254916 5:150204855-150204877 CATGATGCTGGGCTTCAAGCCGG + Exonic
1004466268 6:15888151-15888173 CCTGCTGGCGACTCTCAAGCTGG - Intergenic
1005264900 6:24101398-24101420 CCTGGATCTGAGCCTCCAGCTGG + Intergenic
1006311725 6:33265781-33265803 CCTACTGCTGACCCACAATCAGG - Intronic
1006416108 6:33904869-33904891 TCTGCTGCTGAGCTCCCAGCGGG + Intergenic
1006516775 6:34549814-34549836 CCTGCTGCTCAGCCCCCAGCCGG + Intronic
1006814089 6:36839267-36839289 CCTGCAGGTGAGCCTCCCGCTGG - Exonic
1007826639 6:44605823-44605845 CCTGCTGGAGAGGCCCAAGCTGG - Intergenic
1012570024 6:100712867-100712889 GCTGCTGCAGAGCCTGAGGCAGG - Intronic
1012964406 6:105657699-105657721 GCTCCTGCTGTGGCTCAAGCAGG + Intergenic
1013381239 6:109573441-109573463 CCTGAAACTGAGCCTGAAGCAGG - Exonic
1014414809 6:121170466-121170488 CCTGATACTGAGCCTCTAACAGG + Intronic
1014484729 6:121984871-121984893 CCTGAGCCTGAGCCTCTAGCAGG - Intergenic
1015621908 6:135140597-135140619 CCTACTGCTGAGGGTCAATCTGG + Intergenic
1016283338 6:142445075-142445097 CCTTTTGCTGAGCTTCAATCAGG + Exonic
1016633036 6:146254266-146254288 CCTGGGACTGAGTCTCAAGCAGG - Intronic
1021579911 7:22141693-22141715 CTTGCTGCTGAGCCTCCACTGGG + Intronic
1023684518 7:42720929-42720951 TCTGCTGCTGAACTTGAAGCTGG + Intergenic
1023709114 7:42973259-42973281 TCTGCTGCTGAGCCAAAAGCAGG + Intergenic
1024194650 7:47047227-47047249 CCTGGTGCTGAGCGTGAAGCAGG - Intergenic
1025819141 7:64946957-64946979 CCCCCTGCTGGGCCTCTAGCCGG + Intergenic
1026135981 7:67661148-67661170 CTAGATGCTGAGGCTCAAGCTGG + Intergenic
1027734372 7:81914405-81914427 GCTGCTGCTGAGTCTGCAGCGGG + Intergenic
1028792254 7:94866431-94866453 CCTGCTTCTGGGACTCCAGCTGG - Intergenic
1029103401 7:98153274-98153296 CCTGCTGCAGAGCCTCCCCCTGG - Intronic
1029379552 7:100204101-100204123 CCTGCTGCTGAGCCTCAAGCAGG + Exonic
1031020278 7:116620369-116620391 CCTGCTGATGATCCTGGAGCTGG + Intergenic
1032066263 7:128773870-128773892 CCTGCTGCTGAGCTGCAACCTGG + Exonic
1032587917 7:133164616-133164638 CCTGGTGATGACCCTCCAGCAGG - Intergenic
1034512277 7:151545726-151545748 CCTGCTGCCCAGCCAGAAGCTGG - Intergenic
1034909047 7:154977375-154977397 CCTGTTGCAGAGCCCCAAGGTGG + Intronic
1035563765 8:627985-628007 CCTGCTGCTGCCCCTTGAGCTGG - Intronic
1035671386 8:1420201-1420223 GCTGATGCAGAGACTCAAGCTGG - Intergenic
1037600707 8:20391556-20391578 CCTGCCTCTGAGTCTCTAGCTGG - Intergenic
1038583326 8:28769019-28769041 CCTGTTAATGGGCCTCAAGCTGG - Intronic
1039577898 8:38639529-38639551 CATGCTGCTGTGCTCCAAGCTGG + Intergenic
1039804297 8:40985292-40985314 CCTGCTGATCCTCCTCAAGCGGG + Intergenic
1041255671 8:55978116-55978138 CCTGGTGCTGTCCCTGAAGCAGG + Intronic
1048422967 8:134295213-134295235 CCTGTTCATGAGCCTCAAGTTGG + Intergenic
1048928732 8:139293883-139293905 CCTGCTGCTGAGGCAGCAGCTGG + Intergenic
1049041036 8:140111942-140111964 CCTGCGCCTGAGCCTCCTGCAGG - Intronic
1049509779 8:143021744-143021766 GCTGCTGCTGAGCCTGCTGCCGG + Exonic
1050099126 9:2099760-2099782 CCAGATGCTGAGCCTCAAAATGG + Intronic
1051097051 9:13477828-13477850 CCTGGTGCTTAGCCCCATGCAGG + Intergenic
1052973095 9:34390729-34390751 GCTGCTGCGGAGGCTGAAGCAGG - Intronic
1053142184 9:35689253-35689275 CCTGCTGCTCCTCCTCCAGCTGG + Exonic
1053372739 9:37576280-37576302 CCGGCTGCTGCGGCTCCAGCGGG - Intronic
1056821637 9:89846147-89846169 CCAGCTGCAGTGCCTCAACCTGG - Intergenic
1056877624 9:90349727-90349749 CCTGCTGCTGATGGCCAAGCAGG + Intergenic
1057186776 9:93061533-93061555 CCTGCTGCTCAGCCTGGAGATGG + Intronic
1058014833 9:100019211-100019233 CCTGCAGCAGAGCCTGAATCTGG - Intronic
1059669189 9:116477149-116477171 CCTGCTGGGGACTCTCAAGCAGG - Intronic
1059693995 9:116713494-116713516 CCTGCTGGTCAGCATCATGCAGG + Intronic
1060397943 9:123329252-123329274 CCTTATTCTGAACCTCAAGCTGG + Intergenic
1062284928 9:135768627-135768649 CCTGCTGCTGAGGATGAAGCAGG - Exonic
1062697738 9:137884106-137884128 CCTGCTCCTGAGCCTGGGGCTGG + Intronic
1203520953 Un_GL000213v1:44158-44180 CGTGGTGCTGAGCCGCAAGCTGG - Intergenic
1186202817 X:7171252-7171274 TCTGCTCCTCAGCCTCAACCTGG + Intergenic
1189833200 X:44995827-44995849 CGTGCTGCTGAACCACAAACTGG - Intronic
1190015526 X:46823717-46823739 CCTGCAGCTGTGCCCTAAGCGGG + Intergenic
1190621422 X:52290296-52290318 CCTGCTCCTGGCACTCAAGCAGG - Intergenic
1191783877 X:64896898-64896920 CCTGCTGCTCAGCCATAAGAAGG - Intergenic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1194808628 X:98362784-98362806 CCTCCTGCTGTCCCTCAAACTGG - Intergenic
1195134001 X:101885413-101885435 CCAGCTACTGAGGCTGAAGCAGG + Intronic
1202580971 Y:26380300-26380322 CCTGCTACAGTGCCCCAAGCTGG + Intergenic