ID: 1029381567

View in Genome Browser
Species Human (GRCh38)
Location 7:100218787-100218809
Sequence GCTCTTTAGAGCCTTCCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029381567 Original CRISPR GCTCTTTAGAGCCTTCCCTC GGG Intronic
901401413 1:9017443-9017465 CCTCTGTACAGCCTTCCTTCTGG - Intronic
903331819 1:22600495-22600517 GCTCTTGTGAGGCCTCCCTCAGG + Intronic
903739025 1:25547598-25547620 GCTCTTCAGAGCCGTTCCACTGG + Intronic
904842518 1:33382312-33382334 TCTCCTTACATCCTTCCCTCTGG + Intronic
909544154 1:76825441-76825463 ACTCTTTGGAGCCATCCTTCTGG - Intergenic
912273028 1:108229461-108229483 CCTCTCTAGAACTTTCCCTCTGG - Intronic
912295191 1:108464861-108464883 CCTCTCTAGAACTTTCCCTCTGG + Intronic
921478452 1:215636663-215636685 TCCCTTTTGAGGCTTCCCTCGGG - Intronic
921495083 1:215829737-215829759 GCTCATTAGAGTCTTGCCTTTGG + Intronic
1062849152 10:729629-729651 GCACTGTACAGCCCTCCCTCGGG - Intergenic
1064094845 10:12416668-12416690 GCTAGTCAGAGCCCTCCCTCCGG - Intronic
1064188489 10:13184890-13184912 GGTGTTTAGAGCCCTCCCACAGG - Intronic
1066186976 10:33019438-33019460 GGTTTTTAGAGCTTTCCCTCAGG - Intergenic
1067700589 10:48568681-48568703 GCTCTTCAGAGCCTGCCGGCTGG + Intronic
1067775542 10:49162575-49162597 GTACTTTAGAGCCTTCCCCGTGG + Intronic
1070590646 10:77798343-77798365 CCTCCTCAGAGCCTTCACTCGGG - Intronic
1071614916 10:87066525-87066547 GAACTTCAGAACCTTCCCTCAGG + Intronic
1073434357 10:103507284-103507306 GCTCTTCAGTGACTCCCCTCAGG - Intronic
1073474998 10:103746972-103746994 CCTCTTTACAGCGTTCCCTAAGG + Intronic
1078639524 11:13082053-13082075 GCTCTTTAGAGTCTCCCTTCTGG + Intergenic
1078874057 11:15376275-15376297 GCTTATTAGCGCATTCCCTCTGG + Intergenic
1079357005 11:19738190-19738212 GCTCTGCAGAGAGTTCCCTCAGG + Intronic
1081127133 11:39335237-39335259 GCTCTTTAGAGTCCTTACTCAGG + Intergenic
1083541830 11:63516548-63516570 GCACTCTTGTGCCTTCCCTCAGG - Exonic
1086827366 11:91516074-91516096 GCTCTTTAGAGTCCTCATTCCGG + Intergenic
1088974582 11:114804317-114804339 TCCCTTTATAGCCTTCACTCAGG + Intergenic
1091194322 11:133718512-133718534 TCTCTTCTGAGCGTTCCCTCAGG - Intergenic
1093956778 12:25229411-25229433 GCTCTTTAGAGATATCCATCTGG - Intronic
1102864230 12:116361340-116361362 GGTTTTTAGAACCTTCCCTGGGG + Intergenic
1104120027 12:125790081-125790103 AATCTTTAGAGCCTTCACTTTGG + Intergenic
1106368193 13:29104488-29104510 GCTCTTAAGAGCATTCCCGCAGG - Intronic
1111699492 13:91668270-91668292 GCTCTTCAAATCCTTGCCTCTGG + Intronic
1112192615 13:97192637-97192659 GCTCTTTTCAGCCTTTTCTCAGG - Intergenic
1113711773 13:112469849-112469871 CCTCTTTAGAGCCTCGCCTCGGG + Intergenic
1117617023 14:57544615-57544637 TCTCTTCAGAGCCTTCAGTCAGG + Intergenic
1121232643 14:92369017-92369039 GGTCTTTAGAGTCCTCCCTCAGG - Intronic
1123626637 15:22231429-22231451 ACTCTTAAGAGGCTTCCTTCTGG + Intergenic
1128125043 15:65185755-65185777 GCACTTTAGAGACTTCCCCCTGG - Intergenic
1131851094 15:96544018-96544040 GCTCTTAGGAGCCTTCACTATGG + Intergenic
1132354753 15:101163014-101163036 GCTCTTGAGAGGCTGGCCTCCGG - Intergenic
1132758389 16:1496982-1497004 GTTCTTTTGTGCCTTCCCGCCGG + Intronic
1140771684 16:78211306-78211328 GCTCTTCAAAGCCATGCCTCTGG - Intronic
1140929032 16:79610029-79610051 GCTCTTTTGAGCGTTCGCTCGGG - Intergenic
1141500542 16:84441330-84441352 TCTCCTTAGAGCCTTCCCAGTGG - Intronic
1141718202 16:85739176-85739198 GCTCTGTGCAGCTTTCCCTCTGG - Intronic
1141977349 16:87525985-87526007 ACTCTTAAGAGGCTTCCTTCTGG - Intergenic
1143408776 17:6696209-6696231 GCTCCTTATGGCCTTCCCCCAGG - Intronic
1144360545 17:14487557-14487579 GGTCTTAAGAGCCTTCCATGGGG - Intergenic
1144734580 17:17547921-17547943 GCTCTTTAGCTCCTTCCTTCTGG - Intronic
1145354472 17:22128893-22128915 GCTCTTGAGCACCTTCTCTCAGG - Intergenic
1147179842 17:38677349-38677371 GCCCTTTCTAGCCTTCACTCTGG - Intergenic
1147183952 17:38703937-38703959 GCTCTTTAGTACCTTTCATCCGG - Intergenic
1150032230 17:61751321-61751343 CCTGTTTAGCCCCTTCCCTCAGG - Intronic
1154350767 18:13581475-13581497 GTTCTTTGGAGCCTTCTTTCTGG + Intronic
1156849319 18:41707914-41707936 GCCCTTTAGAGGTTTCCCACTGG + Intergenic
1161138812 19:2636253-2636275 GCTCTCTACTGCCTTCACTCAGG + Intronic
1162175543 19:8827465-8827487 ACTCTTTAGTGTCTTCCCACTGG + Intronic
1163133148 19:15289155-15289177 TCTCTTTAGGGCCTGGCCTCTGG - Intronic
1164625625 19:29725793-29725815 GTTGTTTGGATCCTTCCCTCTGG - Intergenic
1165169607 19:33882488-33882510 CCTCCTTAAAGCCTGCCCTCAGG + Intergenic
925022665 2:583961-583983 GCTCTGTCGAGCCTTCCCCCAGG - Intergenic
926921613 2:17946027-17946049 GCTCTTTGCAAGCTTCCCTCTGG + Intronic
928583780 2:32736841-32736863 ACTGGTGAGAGCCTTCCCTCTGG + Intronic
929617588 2:43324238-43324260 GATCTTTAGAGCCTTCTGCCAGG + Intronic
930046376 2:47176307-47176329 CCTCTTTCGCGCCATCCCTCTGG + Intronic
932892675 2:75610349-75610371 GCTCTTTAGAGGCTCCCTGCCGG - Intergenic
940196654 2:151102737-151102759 GCTATTTACTTCCTTCCCTCTGG - Intergenic
1171452224 20:25244218-25244240 GGTTTTTAGAGCCTTTCCTGTGG + Intergenic
1177793911 21:25752593-25752615 ACTCTTTTCAGCTTTCCCTCAGG - Intronic
1179216429 21:39370992-39371014 GGTGTTTAGAGCCCTCCCTTGGG + Intergenic
1179288867 21:40001092-40001114 CCTCATTAGAGTCTTCACTCTGG - Intergenic
1180881987 22:19210766-19210788 GCTTTTTAGAGCCCAGCCTCTGG + Intronic
1183260237 22:36790118-36790140 GCTCTTTAAAGCCCTCCCACTGG - Intergenic
1183378603 22:37479422-37479444 GCTTCTGAGAGCCTTCCCGCTGG - Exonic
1184827451 22:46962671-46962693 GCTCTTTGAAGCCATCCCTCAGG - Intronic
951927963 3:27930503-27930525 GCTCTTCAGAGCTTTCCCAAGGG + Intergenic
952969287 3:38640851-38640873 GCTCTTTCAATCCTTCCCTGAGG - Intronic
954614098 3:51960727-51960749 GCAGTTTTGAGCCTTGCCTCAGG - Intronic
955222658 3:57036204-57036226 GCTCTTGAGAGTCTTCGCACTGG - Intronic
964174916 3:153816264-153816286 GCTCTCTAGAGTTTTCTCTCTGG + Intergenic
964542209 3:157792012-157792034 ACCCTTTAGACCCTTTCCTCTGG + Intergenic
966614189 3:181896711-181896733 TCGCTTTAGAGTATTCCCTCAGG - Intergenic
969289279 4:6228255-6228277 GCACTCTAGAGGGTTCCCTCTGG - Intergenic
970122675 4:12774513-12774535 GCTATGTAGAGCCTTCGGTCAGG + Intergenic
971379294 4:26082174-26082196 TCTCTACAGCGCCTTCCCTCTGG + Intergenic
971828553 4:31660042-31660064 GCTCTATAGAGCTTTCCTACTGG + Intergenic
972725131 4:41740613-41740635 GCTCTTTAGAGCCTTCCAAGAGG - Intergenic
974967650 4:68782198-68782220 GCTCCTTAGAGACTTCCCAAGGG - Intergenic
983488564 4:168360972-168360994 GCTCTGTAGACCCATTCCTCAGG - Intronic
985703147 5:1385850-1385872 GCTCTCTCGTGCCTTCCCTGGGG - Intergenic
986267266 5:6201350-6201372 GCCCTGTAGAGCCATCCCTTGGG - Intergenic
990704549 5:58513877-58513899 GCTGTTTATAGACCTCCCTCTGG - Intergenic
991484551 5:67120864-67120886 GCTCTGTAAAGCTATCCCTCAGG + Intronic
992284028 5:75214119-75214141 GCCTTTTAGAGCGTTCCCTCTGG + Intronic
992291259 5:75282435-75282457 GCTCTTTACATCCCTGCCTCAGG + Intergenic
992527605 5:77628168-77628190 CCTCTTTGGGGCCTTCCCTAAGG - Intergenic
993307529 5:86290500-86290522 CCTCTCTAGAACTTTCCCTCTGG + Intergenic
993653395 5:90550164-90550186 GCACTTCAGATTCTTCCCTCTGG + Intronic
995735381 5:115295551-115295573 GCTCATGACAGCCTTCCTTCAGG + Intronic
999104816 5:149062086-149062108 GCTCCTTAGCTCCTTCTCTCAGG + Intronic
1001380820 5:171305323-171305345 TGTCTTTAGAGCCTCCCATCAGG + Intergenic
1001672113 5:173482148-173482170 GCTGTTTAGAGACCTACCTCTGG - Intergenic
1003278869 6:4675044-4675066 GCTCCATCGAGCCTTCCCTGAGG + Intergenic
1006763592 6:36485413-36485435 TCTCTTGAGAGCCTTCCATGGGG - Intronic
1012613212 6:101242080-101242102 CCTCTTTAGAGAGTTCCCTCAGG + Intergenic
1014537651 6:122634521-122634543 GAACTTTGGAGCCTTCCCTCAGG - Intronic
1018607305 6:165611404-165611426 GCTCATCAGAGCCCTTCCTCAGG - Intronic
1018930889 6:168239623-168239645 GCTCTTCAGGGCCCTGCCTCAGG - Intergenic
1020432620 7:8129017-8129039 CTTCTTTAAAGCCTTCCTTCTGG - Intronic
1021532064 7:21657771-21657793 CTTCTTAAGGGCCTTCCCTCTGG - Intronic
1022748388 7:33196905-33196927 TCTCTTTATAACCTTCCCCCAGG - Intronic
1024261619 7:47577863-47577885 GCTCCTCAGAGCCACCCCTCAGG - Intronic
1029381567 7:100218787-100218809 GCTCTTTAGAGCCTTCCCTCGGG + Intronic
1029401003 7:100346114-100346136 GCTCTTTAGAGCCTTCCCTCGGG + Intronic
1032882304 7:136102850-136102872 GCTCTTTAAATCCTTGCTTCAGG - Intergenic
1037182845 8:16028051-16028073 CCTCTTTAGAGATTTCCTTCTGG - Intergenic
1038481081 8:27902232-27902254 GCTCTGGACAGCCTCCCCTCAGG - Intronic
1039224182 8:35369757-35369779 GCTCTTTATAGCCTGTTCTCAGG - Intronic
1040434648 8:47378923-47378945 GCTCTTTAGAGATTTACATCTGG - Intronic
1041460098 8:58101909-58101931 GCTTTTTAGTGCCTTGCCTTGGG - Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1047758145 8:127934396-127934418 GCCCCTTGAAGCCTTCCCTCTGG + Intergenic
1047991627 8:130292421-130292443 GCTTTGTAAAGCCTTCCCTCTGG - Intronic
1049062199 8:140285440-140285462 GCAGTTCAGAGCCATCCCTCAGG - Intronic
1051662912 9:19442491-19442513 GCTCTGTAGAGCCTGGTCTCAGG - Intronic
1056721128 9:89073052-89073074 GCTCTCTGGAATCTTCCCTCTGG + Intronic
1057601140 9:96458435-96458457 GCTCTTTCGAGCATCCCCTCCGG - Exonic
1058013367 9:100003521-100003543 GCTCTTAAGAGTCTTCACACTGG + Intronic
1060238559 9:121884163-121884185 GCTCCTTAGGGCTGTCCCTCTGG - Intronic
1060705209 9:125792409-125792431 GCTCTACAGAGCCTACCTTCTGG - Intronic
1061380090 9:130250744-130250766 GCTCTTTATTTCCTTCCTTCAGG + Intergenic
1188220476 X:27535429-27535451 GCTTTTTAAAGCCATCACTCTGG - Intergenic
1192143500 X:68664603-68664625 GCTCTTTAGAGAGACCCCTCAGG + Intronic
1192218638 X:69181387-69181409 GCATTTTAGAACCTTCACTCTGG + Intergenic
1193868153 X:86762456-86762478 TCTCTTTAGAGCTTTCCATATGG + Intronic
1194948760 X:100099582-100099604 CACCTGTAGAGCCTTCCCTCAGG - Intergenic
1195899600 X:109783591-109783613 GCTGTTTAGAGCATTGCCTCCGG - Intergenic
1198919900 X:141713805-141713827 GCTCTCTAAACACTTCCCTCCGG + Intergenic
1199393437 X:147307587-147307609 CCTCTTCACAGCCTTCCCTGGGG + Intergenic
1199635000 X:149806000-149806022 GCTCTGCTGAGTCTTCCCTCAGG - Intergenic