ID: 1029382733

View in Genome Browser
Species Human (GRCh38)
Location 7:100224057-100224079
Sequence TGCTCCGAGGAGGGCAGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029382723_1029382733 18 Left 1029382723 7:100224016-100224038 CCACGTTCAGGGCCAGCCAGGTG 0: 2
1: 0
2: 2
3: 12
4: 153
Right 1029382733 7:100224057-100224079 TGCTCCGAGGAGGGCAGCTCTGG 0: 2
1: 0
2: 2
3: 16
4: 207
1029382726_1029382733 2 Left 1029382726 7:100224032-100224054 CCAGGTGGCATCCGCCACACTCA 0: 1
1: 1
2: 0
3: 5
4: 133
Right 1029382733 7:100224057-100224079 TGCTCCGAGGAGGGCAGCTCTGG 0: 2
1: 0
2: 2
3: 16
4: 207
1029382720_1029382733 28 Left 1029382720 7:100224006-100224028 CCGCCGGACACCACGTTCAGGGC 0: 2
1: 0
2: 0
3: 4
4: 80
Right 1029382733 7:100224057-100224079 TGCTCCGAGGAGGGCAGCTCTGG 0: 2
1: 0
2: 2
3: 16
4: 207
1029382725_1029382733 6 Left 1029382725 7:100224028-100224050 CCAGCCAGGTGGCATCCGCCACA 0: 1
1: 1
2: 1
3: 3
4: 125
Right 1029382733 7:100224057-100224079 TGCTCCGAGGAGGGCAGCTCTGG 0: 2
1: 0
2: 2
3: 16
4: 207
1029382721_1029382733 25 Left 1029382721 7:100224009-100224031 CCGGACACCACGTTCAGGGCCAG 0: 2
1: 0
2: 1
3: 10
4: 127
Right 1029382733 7:100224057-100224079 TGCTCCGAGGAGGGCAGCTCTGG 0: 2
1: 0
2: 2
3: 16
4: 207
1029382728_1029382733 -9 Left 1029382728 7:100224043-100224065 CCGCCACACTCAGGTGCTCCGAG 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1029382733 7:100224057-100224079 TGCTCCGAGGAGGGCAGCTCTGG 0: 2
1: 0
2: 2
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029382733 Original CRISPR TGCTCCGAGGAGGGCAGCTC TGG Exonic