ID: 1029390501

View in Genome Browser
Species Human (GRCh38)
Location 7:100271422-100271444
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029390494_1029390501 -8 Left 1029390494 7:100271407-100271429 CCGTGGCGACGGGGGCCGGCCCA No data
Right 1029390501 7:100271422-100271444 CCGGCCCAACCGAGGGATGGGGG No data
1029390486_1029390501 2 Left 1029390486 7:100271397-100271419 CCTCCCCACGCCGTGGCGACGGG No data
Right 1029390501 7:100271422-100271444 CCGGCCCAACCGAGGGATGGGGG No data
1029390484_1029390501 3 Left 1029390484 7:100271396-100271418 CCCTCCCCACGCCGTGGCGACGG No data
Right 1029390501 7:100271422-100271444 CCGGCCCAACCGAGGGATGGGGG No data
1029390491_1029390501 -2 Left 1029390491 7:100271401-100271423 CCCACGCCGTGGCGACGGGGGCC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1029390501 7:100271422-100271444 CCGGCCCAACCGAGGGATGGGGG No data
1029390492_1029390501 -3 Left 1029390492 7:100271402-100271424 CCACGCCGTGGCGACGGGGGCCG 0: 1
1: 0
2: 3
3: 3
4: 107
Right 1029390501 7:100271422-100271444 CCGGCCCAACCGAGGGATGGGGG No data
1029390490_1029390501 -1 Left 1029390490 7:100271400-100271422 CCCCACGCCGTGGCGACGGGGGC 0: 1
1: 0
2: 3
3: 5
4: 61
Right 1029390501 7:100271422-100271444 CCGGCCCAACCGAGGGATGGGGG No data
1029390482_1029390501 19 Left 1029390482 7:100271380-100271402 CCGCGCTCAGCGGAATCCCTCCC 0: 4
1: 0
2: 0
3: 4
4: 99
Right 1029390501 7:100271422-100271444 CCGGCCCAACCGAGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type