ID: 1029403395

View in Genome Browser
Species Human (GRCh38)
Location 7:100358779-100358801
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 2, 1: 1, 2: 4, 3: 37, 4: 495}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029403395_1029403407 20 Left 1029403395 7:100358779-100358801 CCCTTCTCCTTCTATTACCCCTG 0: 2
1: 1
2: 4
3: 37
4: 495
Right 1029403407 7:100358822-100358844 ACGTGAGAATATCCTGGAGACGG 0: 2
1: 0
2: 0
3: 11
4: 143
1029403395_1029403409 22 Left 1029403395 7:100358779-100358801 CCCTTCTCCTTCTATTACCCCTG 0: 2
1: 1
2: 4
3: 37
4: 495
Right 1029403409 7:100358824-100358846 GTGAGAATATCCTGGAGACGGGG 0: 2
1: 0
2: 0
3: 4
4: 120
1029403395_1029403408 21 Left 1029403395 7:100358779-100358801 CCCTTCTCCTTCTATTACCCCTG 0: 2
1: 1
2: 4
3: 37
4: 495
Right 1029403408 7:100358823-100358845 CGTGAGAATATCCTGGAGACGGG 0: 2
1: 0
2: 0
3: 5
4: 77
1029403395_1029403404 14 Left 1029403395 7:100358779-100358801 CCCTTCTCCTTCTATTACCCCTG 0: 2
1: 1
2: 4
3: 37
4: 495
Right 1029403404 7:100358816-100358838 TTCCCAACGTGAGAATATCCTGG 0: 1
1: 0
2: 1
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029403395 Original CRISPR CAGGGGTAATAGAAGGAGAA GGG (reversed) Exonic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900721958 1:4182439-4182461 TAGAGTTAATATAAGGAGAAAGG + Intergenic
900787902 1:4660305-4660327 CAGGGGTCAAAGAAGGAGTGGGG + Intronic
900841366 1:5051144-5051166 TAGAGTTAATATAAGGAGAAAGG - Intergenic
900859292 1:5215864-5215886 AAAGGGTTATAGTAGGAGAAAGG + Intergenic
901588618 1:10319751-10319773 CTGGGGTAGTGGTAGGAGAAAGG - Intronic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
906194145 1:43919548-43919570 CTAGGGCAATAGAAGGACAAGGG + Intronic
906258900 1:44371268-44371290 CTGGGGTAGTAGCAGGTGAATGG + Intergenic
906857725 1:49326499-49326521 CAGGGATAGTATAAAGAGAAGGG + Intronic
907582224 1:55582639-55582661 GAGGGGCAATGGAAGGAGGAAGG + Intergenic
907646617 1:56250951-56250973 CATGGGGAGTAGAAGCAGAAAGG - Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
910161689 1:84278896-84278918 CAGAGGGAATATGAGGAGAAAGG + Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910631286 1:89357508-89357530 CAAAGGTAAAAGAAGGAGACAGG + Intergenic
910793041 1:91070756-91070778 GAGGGGTACTTAAAGGAGAAAGG + Intergenic
910958697 1:92737237-92737259 CTGGGTTAATAGAATGAGAGGGG + Intronic
911513053 1:98831622-98831644 TAGGGGTAGGAGAAGGAGATTGG - Intergenic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
915598503 1:156908437-156908459 CAGGTGTCACAGAAGGGGAAAGG + Intronic
915702285 1:157807304-157807326 CAGGGGTAAGATAAGGAGGGAGG - Intronic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
916949413 1:169763717-169763739 GAGAGGTAATATAAGGAAAAGGG - Intronic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917766331 1:178221992-178222014 CAGGGGTAAAGAAAGGATAAAGG - Intronic
917968542 1:180193467-180193489 GAGGGGTAAAAGCAGGAGATTGG + Intronic
918008867 1:180567762-180567784 CTGGGGTGAGAGAAGGAAAATGG - Intergenic
918157247 1:181860430-181860452 CAGGTGAAAAAGAAGGGGAATGG + Intergenic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
921520574 1:216150708-216150730 TAGAGTTAATATAAGGAGAAAGG - Intronic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922609176 1:226911698-226911720 CACTTGTAATAGAAGGAGAATGG - Intronic
923051323 1:230393097-230393119 AAGGGGAAAAAGAAGGGGAAGGG + Intronic
923075738 1:230607164-230607186 TAGAGTTAATATAAGGAGAAAGG - Intergenic
923208739 1:231783895-231783917 AAGGGATAATGGAGGGAGAAAGG - Intronic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
923660688 1:235954664-235954686 AAGGGGCAATAACAGGAGAAGGG + Intergenic
1062791542 10:309512-309534 CAGGTGTGATAGCAGGAGTATGG - Intronic
1063724765 10:8624596-8624618 CACCTGTAATATAAGGAGAAAGG - Intergenic
1064121741 10:12624958-12624980 AAGGAGGAAGAGAAGGAGAAGGG - Intronic
1064877135 10:20006914-20006936 CAGAGGAAATACAAGAAGAAAGG - Intronic
1065737315 10:28765820-28765842 CAGAGGTAATGGAATGAGAGTGG + Intergenic
1065778387 10:29143593-29143615 CAGGGGATCTGGAAGGAGAATGG - Intergenic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1070111338 10:73489836-73489858 TAGGTGTAACAGAAGCAGAAAGG - Intronic
1070665261 10:78338142-78338164 CAGGGGTTGTGGAAGAAGAATGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071431882 10:85612928-85612950 CAGGAGGAATATAGGGAGAAAGG + Intronic
1072295882 10:94009228-94009250 CAGGGGCAAGAGACAGAGAAGGG + Intronic
1072301514 10:94066669-94066691 CAGGTGTAATGGAAAGACAAGGG - Intronic
1073026140 10:100488606-100488628 CAGGGGTACTGGAAGGAGGGTGG - Intronic
1073709126 10:106018681-106018703 TAGGGTTGATATAAGGAGAAAGG + Intergenic
1073806365 10:107103029-107103051 CAGGAGTGTTGGAAGGAGAAAGG - Intronic
1074622950 10:115145202-115145224 CAAGGGTTATATAAGGAGATGGG + Intronic
1075217658 10:120552478-120552500 CAATGGTGATAGAATGAGAATGG - Intronic
1075425998 10:122342112-122342134 CAGGGGAAATAGAAACAGATAGG - Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1076066909 10:127456025-127456047 CAAGGGGGATGGAAGGAGAAAGG - Intergenic
1076145356 10:128114672-128114694 CAGGGGTTATTGAAGGAGATAGG - Intronic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078332416 11:10436164-10436186 CAGGGGGACAAGAAGGCGAAAGG + Intronic
1078346991 11:10558915-10558937 CAGGGTTACAATAAGGAGAAGGG + Exonic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1079154530 11:17932598-17932620 AAGGAGCCATAGAAGGAGAAAGG + Intronic
1079637960 11:22769053-22769075 CAGGGTTAATAGAAAAAGTATGG + Intronic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1081208254 11:40300095-40300117 CAGGAGTAAGAGAGAGAGAAAGG + Intronic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081826438 11:46058170-46058192 TGGGGGTAAGAGAAGGAGAAAGG + Intronic
1084653026 11:70500120-70500142 GTGGGGCACTAGAAGGAGAAGGG - Intronic
1085661407 11:78370747-78370769 AAGGGGTAAATGGAGGAGAAAGG + Intronic
1086414622 11:86576436-86576458 AAGGGTGAATAGAAGCAGAATGG - Intronic
1086430014 11:86727562-86727584 CAAGGCTAAAAAAAGGAGAAAGG + Intergenic
1087197502 11:95315831-95315853 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088042361 11:105402821-105402843 AAGGTGAAATACAAGGAGAAGGG + Intergenic
1088650078 11:111949774-111949796 CAGAGGTGATGGAAGGAGGAAGG - Intronic
1088725812 11:112633589-112633611 GAGGATTAATACAAGGAGAATGG - Intergenic
1088843732 11:113647807-113647829 CACGGGTAATAGAATGTGAAAGG + Intergenic
1088988022 11:114927129-114927151 GGGAGGAAATAGAAGGAGAAGGG + Intergenic
1089704309 11:120266385-120266407 CAGGGGTAAGAGAAGAGGAAGGG - Intronic
1089843615 11:121440742-121440764 TAGTGGTAATAGACTGAGAAGGG - Intergenic
1090098749 11:123771572-123771594 CATGGGAATGAGAAGGAGAAAGG - Intergenic
1090810373 11:130235261-130235283 CAGGTGTTAGAGAAGAAGAATGG + Intronic
1090857940 11:130627075-130627097 CAAGGGAAAAAGAAGGACAAAGG + Intergenic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1093123867 12:15305549-15305571 CAGGGGTTATAGAAAGAGATAGG - Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094719509 12:33049019-33049041 CAGGAGGAAAAGAAAGAGAAAGG - Intergenic
1094826367 12:34272257-34272279 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1095323971 12:40864490-40864512 CAGGGGTAAGAGGAGGGGATGGG - Intronic
1096836671 12:54355649-54355671 AAGGGGAGATACAAGGAGAATGG - Intergenic
1097922889 12:65095694-65095716 CAGTTGTAATAGAAGGAAATAGG + Intronic
1098303235 12:69075819-69075841 CAGGGGGAAGAGGAGGATAATGG + Intergenic
1098604111 12:72369399-72369421 CAGGAGTAAAGGATGGAGAAAGG + Intronic
1099851474 12:88102443-88102465 CAGGGGTAAGAGAAAGGGATGGG + Intronic
1099947520 12:89261474-89261496 CTGGGGTGATAGAAGGGGAAAGG + Intergenic
1100062842 12:90602694-90602716 CAGGTGTAATAAATAGAGAATGG - Intergenic
1100343188 12:93701238-93701260 CAGGAGGAAGAGGAGGAGAAGGG - Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101635628 12:106538774-106538796 CAGGGGCAATTGATTGAGAAGGG + Intronic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102420512 12:112799677-112799699 CAGGGGTTAGGGAAGGTGAAGGG - Intronic
1104075839 12:125388971-125388993 GAGGGGCAATAGAAAGACAAAGG - Intronic
1104796667 12:131524852-131524874 CAGGAGTAAAGCAAGGAGAAGGG + Intergenic
1105703397 13:22950793-22950815 GAGGAGAAATAGAAGGAGACAGG + Intergenic
1105983027 13:25538201-25538223 CAAGGGTCATGGCAGGAGAAGGG - Intronic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1108931822 13:55834367-55834389 CAGAGGTCATAGAAAGAGAAAGG + Intergenic
1110139219 13:72106515-72106537 CAGTGGTAATTGAAAGATAATGG + Intergenic
1110146014 13:72190953-72190975 CTGGGGTGATAGAATGACAAGGG - Intergenic
1110748734 13:79087624-79087646 CAGGTGAAATAGATTGAGAAAGG + Intergenic
1110880766 13:80569513-80569535 TATGGGCAACAGAAGGAGAAAGG - Intergenic
1111294137 13:86257699-86257721 CAGGGGTAAGAGGCAGAGAAAGG - Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1113371249 13:109727517-109727539 CAGGGGTCATTGCAGGAGACGGG + Intergenic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1116264375 14:42667907-42667929 CAGGGGTTATTAAAGGAGAGAGG + Intergenic
1116682513 14:47991564-47991586 GGGGGGAAATAGAAGGAAAAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117402488 14:55370942-55370964 GAGGGGAAAAAGAAGCAGAAAGG - Intronic
1117520227 14:56544188-56544210 AATGGGTAATAGAAGAAGCAAGG - Intronic
1117803800 14:59469592-59469614 GGGGGGTAAAAGAAGGGGAAAGG + Intronic
1118095111 14:62527716-62527738 CAGGGGTTAGAGAATAAGAAGGG + Intergenic
1118201672 14:63679870-63679892 CAGGAGGAAGAGAAGGTGAAGGG + Intergenic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118936699 14:70295362-70295384 TAGAGTTAATATAAGGAGAAAGG + Intergenic
1119428675 14:74551879-74551901 CCTGGGTAATAGAGGGAGAATGG - Intronic
1120278859 14:82413580-82413602 GAGGGGAAATAGAAGGGGATAGG - Intergenic
1120691858 14:87601591-87601613 AAGGTGTAATGGAATGAGAATGG - Intergenic
1121408119 14:93731622-93731644 AATGGGGAAGAGAAGGAGAAAGG - Intronic
1122041510 14:98990962-98990984 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1122137437 14:99642849-99642871 AATGGGTAATAGAAGCAGAGAGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122627979 14:103093979-103094001 CAGGGAAAATCCAAGGAGAACGG - Intergenic
1123188071 14:106539129-106539151 CTGGGGTAATGGTAGAAGAAGGG - Intergenic
1123678642 15:22739478-22739500 AAGGGGGAAGGGAAGGAGAAAGG - Intergenic
1123736377 15:23188189-23188211 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124287083 15:28411166-28411188 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124295618 15:28500463-28500485 AAGGGGAAAGCGAAGGAGAAAGG + Intergenic
1124609417 15:31198132-31198154 TAGGGATAGAAGAAGGAGAAGGG - Intergenic
1124616983 15:31249017-31249039 CTGGGGTAAAATAAGGAGAGAGG + Intergenic
1125152326 15:36546949-36546971 CAATGGTAATAGACTGAGAAGGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125495126 15:40186118-40186140 TAGTGGTAATGAAAGGAGAAGGG + Intronic
1126335268 15:47580509-47580531 GAGAGGTAATAGAATAAGAAGGG - Intronic
1126351853 15:47752123-47752145 CAGGAGTAATAGAAGGTTACTGG + Intronic
1127767730 15:62203898-62203920 AAGGGGGAAGAGAAGGAGAGGGG - Intergenic
1128466124 15:67913852-67913874 CAGGGGTTAAGGAAAGAGAATGG + Intergenic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1129393380 15:75231721-75231743 CAGGGGTGGGAGAGGGAGAAGGG - Intergenic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1129862309 15:78872563-78872585 CAGTGATAATAGAATGGGAAAGG - Intronic
1131070705 15:89463944-89463966 CAGGTGAAATAGATGGAGAGTGG - Intergenic
1131475119 15:92731813-92731835 CAGGGCTACTAGAAGGGGGAGGG + Intronic
1131723298 15:95195319-95195341 CAGTTGTTAAAGAAGGAGAAGGG + Intergenic
1132327689 15:100985456-100985478 CAGGGGAAATTGAGGCAGAAAGG + Intronic
1133552586 16:6871591-6871613 CCAGGAGAATAGAAGGAGAATGG - Intronic
1133649149 16:7794013-7794035 AAGGGATAATATAAGGAGAGTGG + Intergenic
1133914485 16:10096757-10096779 TAGGGGAAGTACAAGGAGAATGG - Intronic
1133997872 16:10761945-10761967 GAGGGGCAATGGAAGGAGGAGGG + Intronic
1134397886 16:13882073-13882095 CAAGGGTACTAGAAGGACATGGG + Intergenic
1135124609 16:19798039-19798061 CAGGGGTAAGAGGCAGAGAAAGG + Intronic
1135147514 16:19975416-19975438 CAGGGGTATTGGAATGAGAATGG - Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1136469881 16:30473026-30473048 CAGGGATCTTGGAAGGAGAAAGG + Intronic
1138758489 16:59516895-59516917 TAGAGTTAATATAAGGAGAAAGG + Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139203301 16:65001436-65001458 CAGGGTAAATAGAAGAACAAAGG - Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140251960 16:73302154-73302176 AAGGGGGAAAAGAAAGAGAAAGG - Intergenic
1140452705 16:75083858-75083880 CAGGAGTACTAGAAAGAGAAAGG + Intronic
1141250266 16:82349791-82349813 CAGGGGCACTAGAAAGAGGAAGG + Intergenic
1142814481 17:2414574-2414596 CAGGGGAACTGAAAGGAGAAGGG - Intronic
1143986029 17:10915208-10915230 CATAGTCAATAGAAGGAGAAAGG + Intergenic
1144010207 17:11140750-11140772 AAGAGGTACAAGAAGGAGAAAGG - Intergenic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1146570079 17:33944895-33944917 CAGGGGTGAGGGAAGCAGAAAGG - Intronic
1147210288 17:38869433-38869455 GTGGTGTAACAGAAGGAGAAAGG + Intergenic
1147219330 17:38919334-38919356 CAGGGGCAACAACAGGAGAATGG + Exonic
1148569361 17:48655893-48655915 AAGGGGCAATAGTAGGACAATGG - Intergenic
1149016017 17:51909151-51909173 CAGGTGAGATAGAAGGTGAAAGG + Intronic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149267162 17:54939413-54939435 CAGGGGAAATACAATGACAAAGG + Intronic
1149305555 17:55343431-55343453 CAGGGCTAATAGAAGGTGTGGGG + Intergenic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1150256161 17:63746972-63746994 AAGGGGTAATAAATAGAGAAAGG + Intronic
1150381877 17:64727265-64727287 CAGGGGTTATGGTAGGAGGAAGG + Intergenic
1152266256 17:79296746-79296768 GAGTAGTAAAAGAAGGAGAAAGG - Intronic
1152518306 17:80838879-80838901 CAGGGGTGCTGGAAGGACAAAGG + Intronic
1153037262 18:775406-775428 CAGGGTTAATAGCATGAGATGGG - Intronic
1153062708 18:1010814-1010836 CAGAGGTAATAGGAGGGAAAGGG + Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153873349 18:9341428-9341450 CCAGGGTAATAGAATGAGTAGGG - Intronic
1155227272 18:23739568-23739590 AAGATGTAACAGAAGGAGAAGGG + Intronic
1155708416 18:28845340-28845362 CCAGAGTAATAAAAGGAGAATGG + Intergenic
1156999976 18:43512201-43512223 CCCAGGTAATAGAAGGAAAAAGG - Intergenic
1157630726 18:49092774-49092796 GAAGGGTGGTAGAAGGAGAAGGG + Intronic
1158605798 18:58895039-58895061 TAAGGGGAAAAGAAGGAGAATGG - Intronic
1159959064 18:74541485-74541507 GAGGAGTCACAGAAGGAGAAGGG + Intronic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1162082984 19:8230140-8230162 TGGGAGTACTAGAAGGAGAAAGG - Intronic
1163117656 19:15197961-15197983 CAGGGGTAATAGAAGGGGAAGGG + Intronic
1163669811 19:18620835-18620857 GAGGGGACATAGAAGGAAAAAGG - Exonic
1163899556 19:20089616-20089638 TAGAGTTAATATAAGGAGAAAGG + Intronic
1164590751 19:29505477-29505499 CAGGGGTCAGAGGTGGAGAATGG - Intergenic
1165077274 19:33286844-33286866 CAGGGGTAAGGGAATGAGGATGG + Intergenic
1166880816 19:45929017-45929039 CAGGGGCAAGTGATGGAGAATGG - Intergenic
1167713249 19:51125092-51125114 GAGGGGTAGGAGAAGGAGCAGGG - Exonic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
924988165 2:289036-289058 CAGGGGGAAGAGGAGGAGACGGG - Intergenic
925345471 2:3169007-3169029 CAGGAATAAGAGAAAGAGAAGGG + Intergenic
925399597 2:3562685-3562707 CAGGGATATTAGGAGGGGAACGG - Intergenic
925894757 2:8462832-8462854 CAGATGTCAGAGAAGGAGAAAGG + Intergenic
926941137 2:18138304-18138326 CAGGGGGATTAGGAGTAGAATGG + Intronic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927416651 2:22887235-22887257 CAGGCATATAAGAAGGAGAAGGG - Intergenic
928414112 2:31077443-31077465 CTGGGGTAATTGAAGGGAAAAGG - Intronic
929013602 2:37472337-37472359 GAGGAGGAAGAGAAGGAGAAAGG + Intergenic
930017437 2:46980667-46980689 CAGGGGAAATGGAAGGAGTCTGG + Intronic
930343859 2:50152913-50152935 GAGGGAGAAGAGAAGGAGAAAGG - Intronic
931756448 2:65378931-65378953 CAAGGGTAAGCGAATGAGAAAGG + Intronic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933914643 2:86977279-86977301 CAGAAGTAATAGAAAGAGCATGG + Intronic
934008350 2:87792620-87792642 CAGAAGTAATAGAAAGAGCATGG - Intronic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
935771992 2:106433561-106433583 CAGAAGTAATAGAAAGAGCATGG - Intronic
935908077 2:107862384-107862406 CAGAAGTAATAGAAAGAGCATGG + Intronic
935994484 2:108754615-108754637 CAGAAGTAATAGAAAGAGCATGG + Intronic
936129867 2:109827491-109827513 CAGAAGTAATAGAAAGAGCATGG + Intronic
936214830 2:110543994-110544016 CAGAAGTAATAGAAAGAGCATGG - Intronic
936423967 2:112398557-112398579 CAGAAGTAATAGAAAGAGCATGG - Intronic
936577003 2:113665616-113665638 CAGGGGTCATAAGAGGAAAATGG + Intergenic
937470322 2:122168835-122168857 AAGGGGTAATACAGGGAGAGAGG + Intergenic
937749724 2:125460808-125460830 CAAGGGAAAAAGAAAGAGAAGGG - Intergenic
938129974 2:128706886-128706908 CAGAGGTAAGAGAATGAGCAGGG + Intergenic
938640709 2:133275995-133276017 CAGGGGTGATAGAAGTGGAATGG - Intronic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939674310 2:145053069-145053091 AAGGGGTATTACAAGGAGACTGG + Intergenic
940530637 2:154872633-154872655 TAGAGTTAATATAAGGAGAAAGG - Intergenic
941310374 2:163921413-163921435 TGGGAGTAATAGAAGTAGAAAGG - Intergenic
941514452 2:166455544-166455566 GAGGGGGAAGAGAAGGGGAAGGG + Intronic
942471499 2:176265420-176265442 CAGGAGGAAGAGAAAGAGAAGGG - Intergenic
943101870 2:183496621-183496643 CAGGGGTAGTGGAAGTGGAATGG + Intergenic
943299492 2:186180159-186180181 CAGGGGCAGTAGAGGGAGACAGG - Intergenic
943382773 2:187171830-187171852 CTGGGTTCATAGAAGGAGAAAGG + Intergenic
943412347 2:187559867-187559889 TAGAGTTAATATAAGGAGAAAGG + Intronic
943458666 2:188141490-188141512 GAGGGGTTTTAGAAAGAGAAAGG + Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946424509 2:219586018-219586040 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947679285 2:232014975-232014997 CAGAGGTAGTAAAAGGAAAATGG + Exonic
948373240 2:237503975-237503997 CAGGGGCCTTAGAAGCAGAAGGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948807804 2:240460493-240460515 CAAGGGTATTAGCAGGAGAGGGG - Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1169089257 20:2848006-2848028 CAGGGGTAACCAAAGGACAAAGG - Intronic
1169696189 20:8389416-8389438 CAAGGGTAATAGTAGGTGAAAGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171422185 20:25024774-25024796 CAGGGCTCTTAGGAGGAGAAAGG - Intronic
1173191528 20:40880450-40880472 CAGGGGCACTAGAGGGAGACTGG + Intergenic
1173618234 20:44416627-44416649 CATGGGGAATAGAAGGGGCAAGG + Intronic
1173646489 20:44636300-44636322 CAGGGGGAAGAGAGAGAGAAAGG + Intronic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174259635 20:49284528-49284550 CAGGGGAAATAGTAAGAAAAAGG - Intergenic
1174696936 20:52569302-52569324 AAGGGGAAATGGAAGGGGAAGGG - Intergenic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1176115024 20:63428436-63428458 CTGGGGCAAGAGAAGGAGAGGGG + Intronic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1177967009 21:27740259-27740281 CAGTGGTAAGAGGGGGAGAAGGG + Intergenic
1178216907 21:30609022-30609044 AAGGGATAATAGAAGAAGAATGG + Intergenic
1178422721 21:32455229-32455251 AAGGGGCAAGAGAAGGAGAGAGG + Intronic
1178619598 21:34161989-34162011 CTGGGGTACTTGAGGGAGAAGGG + Intergenic
1179145084 21:38760994-38761016 CTGGAGTGAAAGAAGGAGAAAGG - Intergenic
1179356875 21:40668031-40668053 CAGAGTTAATAGAATGAGACTGG - Intronic
1180938290 22:19640292-19640314 CAGGGGCAAGGGGAGGAGAATGG - Intergenic
1181436780 22:22915726-22915748 CAGGAGCCATAGAAGGAAAATGG + Intergenic
1182022307 22:27091242-27091264 AAGGGGTCATTGAGGGAGAATGG + Intergenic
1182332276 22:29559678-29559700 GTGGGGCAAGAGAAGGAGAAGGG - Intronic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1185423238 22:50747057-50747079 CAGGGGTCATAAGAGGAAAACGG - Intergenic
950842093 3:15977559-15977581 CAGGGAGGATAAAAGGAGAAAGG + Intergenic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
952489265 3:33850893-33850915 AAGGGGGAAGGGAAGGAGAAAGG - Intronic
953321842 3:41979616-41979638 CAAGTGTAATAGAAGATGAAGGG + Intergenic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
956265514 3:67392157-67392179 CAGGGGTCAGTGAAGGAGGAAGG - Intronic
956652082 3:71513500-71513522 GTGGGGTAAGAGAAGGAGCAGGG - Intronic
957967430 3:87340404-87340426 CAAGAGTAATAGAAGGTGAGAGG + Intergenic
958885494 3:99721611-99721633 CAGTTGTAATAGAAGAAGAATGG + Intronic
960165743 3:114399398-114399420 CATGTGAAATAGAAGGATAATGG + Intronic
960405786 3:117257755-117257777 AAGGGGGAAGAGGAGGAGAACGG + Intergenic
962045120 3:131750571-131750593 CAGGGATAATAAAAGGACATTGG - Intronic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962345651 3:134617427-134617449 CAGGGGAGGTAGAAGGAGAGAGG + Intronic
963059017 3:141209818-141209840 TAGAGTTAATATAAGGAGAAAGG - Intergenic
963320386 3:143803979-143804001 TAGAGTTAATATAAGGAGAAAGG - Intronic
963521018 3:146360076-146360098 ACTGCGTAATAGAAGGAGAATGG + Intergenic
963602192 3:147388350-147388372 GAGGGGAAAGAAAAGGAGAAAGG - Exonic
963603616 3:147396732-147396754 AAGGGGTAATGGAAGGCGCAGGG + Intronic
963762058 3:149294284-149294306 CTGGGCCTATAGAAGGAGAAAGG - Intergenic
964117161 3:153148347-153148369 AAGGAGAAATAAAAGGAGAATGG - Intergenic
964544677 3:157820857-157820879 CAAGGGTAGTAGCTGGAGAAAGG - Intergenic
964612244 3:158627112-158627134 CAGGGGTATTAGGTGGAGGATGG + Intergenic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
965286301 3:166824490-166824512 TAGAGTTAATATAAGGAGAAAGG + Intergenic
965327730 3:167328629-167328651 CAGGGTGAATGAAAGGAGAATGG - Intronic
965654089 3:170965290-170965312 CAAGGGTAAGAGAAGCAGTATGG + Intergenic
966067445 3:175834270-175834292 TAGAGTTAATATAAGGAGAAAGG - Intergenic
967113529 3:186317035-186317057 CAAGGGTCAGAGAAGGACAAAGG + Intronic
968359976 3:198139860-198139882 GAGGGGTGGGAGAAGGAGAAGGG + Intergenic
969449152 4:7263268-7263290 CTGGTGTAATGGAAGGAAAATGG + Intronic
969511576 4:7620944-7620966 CAGGGGTCGCAGCAGGAGAAGGG - Intronic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970865412 4:20752966-20752988 AAGAGGTCATAGACGGAGAAGGG - Intronic
971359198 4:25921419-25921441 CACGGGGCAAAGAAGGAGAATGG + Intronic
972020936 4:34313196-34313218 CATGGCTAAGAGAGGGAGAAAGG + Intergenic
972169207 4:36324245-36324267 GAGGGGCCAGAGAAGGAGAAAGG - Intronic
972227579 4:37031439-37031461 CAGGGATAATAAAAGGAGAAAGG + Intergenic
972638291 4:40903579-40903601 CAGGGGGAATTAAAGGAGAAGGG + Intronic
972942180 4:44209405-44209427 ATGTGGTAATAGAAGAAGAAAGG - Intronic
973581611 4:52349550-52349572 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
974451122 4:62061613-62061635 CAGGGGTGAAAGATGGAGGATGG - Intronic
974624506 4:64405337-64405359 CAGGAGTGCTAGAAGTAGAAGGG + Intronic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
976916354 4:90379928-90379950 CAGGGGCAAGAGGAAGAGAAGGG + Intronic
977017048 4:91704493-91704515 TGGGAGTAATAGAAGGAGAGGGG - Intergenic
977042192 4:92029190-92029212 TAGAGTTAATATAAGGAGAAAGG - Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
978695486 4:111571932-111571954 CAGTGGTAACAGAAAAAGAATGG + Intergenic
978771222 4:112458014-112458036 CAGTGGTAATAGCAGAGGAAAGG + Intergenic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981358177 4:143815768-143815790 AAGGGGTAATATATGAAGAAAGG - Intergenic
981369421 4:143941887-143941909 AAGGGGTAATATATGAAGAAAGG - Intergenic
981379163 4:144051829-144051851 AAGGGGTAATACATGAAGAAAGG - Intergenic
981559633 4:146033055-146033077 CAGGGGTAGAAGAAGCAGCAAGG + Intergenic
981780979 4:148428712-148428734 TGGGGGTAATAGAAGGGGACAGG - Intronic
981811794 4:148783859-148783881 CAATGGTAATATTAGGAGAAGGG - Intergenic
982018692 4:151181745-151181767 AAGGGGTTATAGAAGAGGAAAGG + Intronic
982962532 4:161858663-161858685 CAGAGCTAATATAATGAGAATGG - Intronic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985984594 5:3504180-3504202 CTGGGGTCAGAGAAGAAGAAGGG - Intergenic
986621384 5:9679199-9679221 CAGGGGGAAAGGAAGGATAATGG + Intronic
986970970 5:13336043-13336065 CAGGAGTAACACAAGGAGCAAGG + Intergenic
987071739 5:14343411-14343433 CAGGGGTTAGAGATGGAGCAGGG - Intronic
987239634 5:15981903-15981925 AAGGGGGAAGAGAGGGAGAAAGG + Intergenic
988465403 5:31486256-31486278 CAGACGTAACACAAGGAGAAAGG + Intronic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
993029849 5:82693715-82693737 CAGAGGAAATATAAGGGGAATGG - Intergenic
994280317 5:97893993-97894015 CACGGATAAAAGAATGAGAAAGG - Intergenic
994553891 5:101272057-101272079 CAGGTGGAAAGGAAGGAGAAAGG + Intergenic
994636003 5:102344876-102344898 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
995460576 5:112399166-112399188 CTGGGGTATAAGGAGGAGAAAGG - Intronic
996012119 5:118492811-118492833 AAAGGGTAAGAGAAGGTGAAGGG + Intergenic
996339367 5:122419041-122419063 CAGGGGTCAAGGAAGGAGAAGGG + Intronic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996576644 5:124983268-124983290 GAGGACTACTAGAAGGAGAAGGG - Intergenic
996801271 5:127406284-127406306 CAGGGGCCAGAGAAAGAGAAGGG + Intronic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
998534373 5:142915770-142915792 CTGGGGTCAAAAAAGGAGAAAGG - Intronic
998744557 5:145243372-145243394 CAGGGTTAACAGAATGAAAAGGG + Intergenic
999379259 5:151108831-151108853 CTGGGGTAGTAAAAGGAGCACGG + Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999784809 5:154881501-154881523 CCCAGGTAATAGAAGGAAAAAGG + Intergenic
1000713994 5:164617595-164617617 CAGGAGAAATAGCAGGAAAAGGG + Intergenic
1001642358 5:173253363-173253385 CAGGTGTTAGGGAAGGAGAATGG + Intergenic
1001879718 5:175232990-175233012 CAGGGGTAATAAAAAGAATAGGG + Intergenic
1005147499 6:22708170-22708192 CAGAGGGAATGGAAGCAGAAAGG - Intergenic
1005211641 6:23472245-23472267 CAGGTGAAGTAGAAGGAGTATGG + Intergenic
1005784347 6:29227675-29227697 CATGGGTAAGAGAGGGTGAAAGG - Intergenic
1006180749 6:32152077-32152099 CCGGGGTAAGAGGAGGAGAGAGG - Intronic
1006944763 6:37777918-37777940 AGGGGGTGGTAGAAGGAGAAGGG + Intergenic
1007762406 6:44140753-44140775 GAGGGGTTATAGAGGCAGAAGGG - Intronic
1008063637 6:47025103-47025125 CAGGTGTAATAGAAGGGGGCAGG - Intronic
1008877416 6:56344795-56344817 CAGGAGGAAAAGAAAGAGAAGGG - Intronic
1009343823 6:62589827-62589849 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010586102 6:77659936-77659958 TAGAGTTAATATAAGGAGAAAGG + Intergenic
1010661568 6:78577428-78577450 AAGGGGTTTTAGAAGCAGAAGGG + Intergenic
1011271969 6:85588962-85588984 CAGGGGTGAAAGAGGTAGAAGGG + Intronic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012079523 6:94737377-94737399 CTGGGGTCTTAGAAGGAGAAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012903217 6:105031935-105031957 CAGGGGTTATAGGTGGGGAAGGG - Intronic
1013573225 6:111451131-111451153 CAGAGGTCATAGAAGAAAAAGGG + Intronic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013945504 6:115717628-115717650 CAGGGGAAAAAGAAGAACAATGG + Intergenic
1014174663 6:118319012-118319034 CGAGAGTAATAGAAGAAGAAAGG - Intergenic
1015023548 6:128506108-128506130 CAATGGTTATAGAATGAGAAAGG - Intronic
1015374803 6:132498066-132498088 CATGGGTAAAAGATGGAGCATGG + Intronic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016505994 6:144779615-144779637 CAGGGGTAACAGAGGCAGAAAGG + Intronic
1016560667 6:145392419-145392441 AAGGAGCAGTAGAAGGAGAATGG - Intergenic
1016674872 6:146752242-146752264 CAGGAGTAAGAGAGAGAGAAAGG + Intronic
1018310739 6:162505700-162505722 AAGGGGTAATAGAAATAGAAGGG + Intronic
1019260013 7:76760-76782 GAGGGGTGGGAGAAGGAGAAGGG - Intergenic
1020814148 7:12883657-12883679 GATGGGTAATAGATGGAGAAAGG + Intergenic
1021434067 7:20594470-20594492 CAGGAGTAATTGAAGAAAAAGGG + Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022373376 7:29790587-29790609 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024572975 7:50739830-50739852 AAGAGGGAATAGAAAGAGAAAGG - Intronic
1024882794 7:54108919-54108941 CAGAGGTCATAGAAGGACAGAGG - Intergenic
1025232092 7:57209408-57209430 CAGGTGAAATAGAAAGAGAAGGG + Intergenic
1026800599 7:73397737-73397759 AAGGGGGAAGAAAAGGAGAAGGG + Intergenic
1026800605 7:73397755-73397777 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026800611 7:73397773-73397795 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1029037791 7:97540493-97540515 CATTGGTAATAAAATGAGAAAGG + Intergenic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029451038 7:100641879-100641901 GAGGGGTAAAAGCAGGAGAGGGG - Intronic
1029679701 7:102099821-102099843 CACCAGTGATAGAAGGAGAAGGG - Intronic
1029799054 7:102926432-102926454 GAGGGATAATAGAAAGATAATGG - Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030038344 7:105427552-105427574 AAGGGGGAATAGGAAGAGAATGG + Intergenic
1030156703 7:106462479-106462501 CAGGGGTATTAGTTGGAGAAAGG + Intergenic
1030170780 7:106600641-106600663 CAATGGTAATAAAAGGAGAATGG + Intergenic
1030782350 7:113617178-113617200 AATAGGTAAAAGAAGGAGAAAGG - Intergenic
1030861674 7:114639440-114639462 CAGTTGTATTAGAAGGAGACTGG + Intronic
1031158913 7:118142972-118142994 ACAGGGTAATAGAAGTAGAAGGG - Intergenic
1031866904 7:127047497-127047519 CAAGGGGAAAAAAAGGAGAAGGG - Intronic
1032204118 7:129846834-129846856 GACAGGTAGTAGAAGGAGAAAGG - Intronic
1032431041 7:131861785-131861807 CAGGGCTACTAGAAGCAGGAAGG - Intergenic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034454603 7:151160634-151160656 CAGGTGTAGTAGAAAGAGACAGG - Intronic
1035161151 7:156950608-156950630 CAGGGGGAAGAAAAGGAAAAGGG + Exonic
1035237678 7:157509233-157509255 GAGGGGGGAGAGAAGGAGAAGGG + Intergenic
1035690203 8:1554914-1554936 TAGGGGCAAAAGAGGGAGAAAGG + Intronic
1036782091 8:11656794-11656816 CAGGGGTACCAGAAACAGAAAGG + Intergenic
1037690659 8:21178799-21178821 CAGGGGTCAAAAAAAGAGAATGG + Intergenic
1038669118 8:29567673-29567695 CAGCAGTAAAAGAAAGAGAAAGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041956904 8:63566213-63566235 CGGAAATAATAGAAGGAGAAAGG - Intergenic
1042677509 8:71338334-71338356 ACAGGCTAATAGAAGGAGAATGG + Intronic
1043185050 8:77138000-77138022 AAGGGGGAAGAGAAAGAGAAAGG - Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043659644 8:82722078-82722100 CAGGGGAAATAGATGCACAATGG - Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044983270 8:97736430-97736452 GAGGGGGAGGAGAAGGAGAAAGG + Intergenic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1046742388 8:117843470-117843492 CAGGGGTAAGAGGAGGTGATGGG + Intronic
1047550998 8:125872093-125872115 CAGGGGTAGAAAAAGGAAAAAGG - Intergenic
1047559914 8:125975768-125975790 TAGGTTTAATAGAAGGAAAAAGG - Intergenic
1047871288 8:129085447-129085469 AAGGGGTAATAGAAACAGGAAGG + Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048978102 8:139684558-139684580 CAGGGGAAAAAGAAGGCAAAAGG + Intronic
1049281504 8:141751173-141751195 CACTGTTAATAGAATGAGAAGGG + Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051932565 9:22404566-22404588 CAAAGGTAATTGAAGGGGAAAGG + Intergenic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052443502 9:28529156-28529178 CTGAGGTACTGGAAGGAGAATGG - Intronic
1052653922 9:31332718-31332740 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1053180722 9:35966780-35966802 CAGGGGTTACAGATGGGGAAGGG - Intergenic
1053453737 9:38214707-38214729 AAGGGGTAGAGGAAGGAGAAGGG + Intergenic
1053547628 9:39040551-39040573 GAGTGGCAATAGAAGGAGAGTGG - Intergenic
1053565262 9:39242716-39242738 TATGGGTAACAGAAAGAGAAAGG + Intronic
1053811731 9:41860206-41860228 GAGTGGCAATAGAAGGAGAGTGG - Intergenic
1053831032 9:42080566-42080588 TATGGGTAACAGAAAGAGAAAGG + Intronic
1054131889 9:61376323-61376345 TATGGGTAACAGAAAGAGAAAGG - Intergenic
1054599522 9:67106872-67106894 TATGGGTAACAGAAAGAGAAAGG - Intergenic
1054618863 9:67327233-67327255 GAGTGGCAATAGAAGGAGAGTGG + Intergenic
1054738742 9:68782991-68783013 CAGGGGCAACAGATAGAGAAGGG - Exonic
1054862988 9:69972250-69972272 CAGGAGTAACAGAGGGGGAAGGG - Intergenic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056324480 9:85464966-85464988 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1058013328 9:100002915-100002937 TAGGAGTAAATGAAGGAGAAAGG - Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058875950 9:109244987-109245009 CAGGCGTCTTTGAAGGAGAAAGG - Intronic
1060500684 9:124151659-124151681 GAGGAGTAAGAAAAGGAGAAAGG - Intergenic
1061366903 9:130176947-130176969 CATGGGGAGGAGAAGGAGAAGGG - Intronic
1062037318 9:134388522-134388544 CAGAGGTAATCGTGGGAGAAAGG - Intronic
1062744684 9:138203704-138203726 GAGGGGTGGGAGAAGGAGAAGGG + Intergenic
1186075280 X:5871674-5871696 CAGGCAGAAAAGAAGGAGAAGGG + Intronic
1186536807 X:10358545-10358567 CAGGTGTAATACAAGGAGACAGG + Intergenic
1187144693 X:16626767-16626789 CAGAGGTCACAGAAGGGGAAGGG - Intronic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1187848786 X:23569862-23569884 CATGGGGATTAGAAGGGGAAAGG - Intergenic
1190993708 X:55582917-55582939 GAAGGGTAAGAGAAAGAGAAAGG + Intergenic
1191761928 X:64655661-64655683 TAGAGTTAATATAAGGAGAAAGG - Intergenic
1192037710 X:67583388-67583410 CAGGAGTGATAGAATGAAAATGG + Intronic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1193121448 X:77827016-77827038 CAGGGTTATTAGAAGGTAAATGG + Exonic
1193503959 X:82316889-82316911 GAGAGGTAATAGAGAGAGAAAGG + Intergenic
1193943702 X:87707341-87707363 CAGTGGTAGTAGATGGGGAAGGG + Intergenic
1193945100 X:87724684-87724706 CAGGGGTAAGTGAAGGAGAGAGG + Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1195666806 X:107439154-107439176 AAGGGTTAATAGTTGGAGAAGGG + Intergenic
1195721436 X:107872661-107872683 CTGGGCTTATAGAGGGAGAAAGG + Intronic
1195948814 X:110245265-110245287 AGGGGGTTACAGAAGGAGAAGGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196039864 X:111190694-111190716 TTGGGCTAATACAAGGAGAAGGG + Intronic
1196525107 X:116722008-116722030 CAGAGTTGATATAAGGAGAAAGG + Intergenic
1198083845 X:133264723-133264745 CAAGGCCAATAGGAGGAGAAGGG - Intergenic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1198590744 X:138177946-138177968 CAGGTGTACTAGAATGATAAAGG + Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199776346 X:151015311-151015333 GAGGTGTATTAGAAGGAAAAAGG - Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1201540456 Y:15100279-15100301 TAGAGTTAATATAAGGAGAAAGG + Intergenic
1201937724 Y:19425731-19425753 TAGAGTTAATATAAGGAGAAAGG - Intergenic