ID: 1029404206

View in Genome Browser
Species Human (GRCh38)
Location 7:100364477-100364499
Sequence GGTGAAGTATGATCACATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029404195_1029404206 28 Left 1029404195 7:100364426-100364448 CCCAGACCCATGGTTTTTATTCC 0: 1
1: 1
2: 1
3: 24
4: 243
Right 1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG 0: 1
1: 0
2: 2
3: 38
4: 207
1029404196_1029404206 27 Left 1029404196 7:100364427-100364449 CCAGACCCATGGTTTTTATTCCA 0: 1
1: 0
2: 2
3: 22
4: 243
Right 1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG 0: 1
1: 0
2: 2
3: 38
4: 207
1029404200_1029404206 21 Left 1029404200 7:100364433-100364455 CCATGGTTTTTATTCCACAGGGG 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG 0: 1
1: 0
2: 2
3: 38
4: 207
1029404204_1029404206 7 Left 1029404204 7:100364447-100364469 CCACAGGGGAAGGATGGTTTGTA 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG 0: 1
1: 0
2: 2
3: 38
4: 207
1029404198_1029404206 22 Left 1029404198 7:100364432-100364454 CCCATGGTTTTTATTCCACAGGG 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG 0: 1
1: 0
2: 2
3: 38
4: 207
1029404194_1029404206 29 Left 1029404194 7:100364425-100364447 CCCCAGACCCATGGTTTTTATTC 0: 1
1: 0
2: 3
3: 19
4: 234
Right 1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG 0: 1
1: 0
2: 2
3: 38
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029404206 Original CRISPR GGTGAAGTATGATCACATCA AGG Intronic
900040691 1:461232-461254 GTTATAGTATGACCACATCAAGG + Intergenic
900062121 1:696203-696225 GTTATAGTATGACCACATCAAGG + Intergenic
901938083 1:12641592-12641614 AGTGAGCTATGATCACACCATGG - Intergenic
902429324 1:16351105-16351127 GCTTAAGAATGATGACATCATGG - Intronic
903195427 1:21683332-21683354 AGTGTATAATGATCACATCAGGG + Intronic
903948133 1:26977086-26977108 ACTGAAGTATGAAAACATCAAGG - Intergenic
904727837 1:32563338-32563360 AGTGAGCTATGATCACACCAAGG + Intronic
906153591 1:43601551-43601573 TGTAATGTATGATCACATCTGGG + Intronic
911083948 1:93960779-93960801 GGTGAGCTAGAATCACATCATGG - Intergenic
917279403 1:173366688-173366710 AGTGCACAATGATCACATCAGGG - Intergenic
922715338 1:227867566-227867588 ACTGAAGTATGATAACATTAAGG + Intergenic
923012381 1:230098664-230098686 ATTGAAGTAAGATAACATCAAGG + Intronic
923460828 1:234207950-234207972 AGTGAGCTGTGATCACATCATGG + Intronic
923708950 1:236369886-236369908 ATTGAAGTATGATAACATCAAGG - Intronic
924036176 1:239940835-239940857 ACTGAAGTATGATAATATCAAGG - Intergenic
1065220068 10:23487428-23487450 GGTGGGCTATGATCACACCATGG + Intergenic
1066069042 10:31786459-31786481 AGTGAGCTATGATCACACCATGG - Intergenic
1068769796 10:60808327-60808349 GGTGAAGTTTGAATACAACATGG + Intergenic
1069939073 10:71941372-71941394 GGTGAAGTGTGCTCACAACGAGG - Intergenic
1070765922 10:79056336-79056358 GGTGAAGTCTGACCAAATCCAGG - Intergenic
1071862518 10:89688767-89688789 ATTGAAGTATGATAACATCAAGG + Intergenic
1073058523 10:100718021-100718043 ACTGAAGTATGATAATATCAAGG + Intergenic
1075830800 10:125409166-125409188 GGTGAAGTTTATTCACAGCAAGG + Intergenic
1075968081 10:126630199-126630221 GGTGAAGTACGAGGGCATCAGGG - Intronic
1076966964 11:97455-97477 GTTATAGTATGACCACATCAAGG + Intergenic
1079390621 11:20018994-20019016 GGAGAAGCCAGATCACATCAGGG + Intronic
1079838016 11:25359092-25359114 GTTGAAGCATGATCCCATGATGG - Intergenic
1080601299 11:33822523-33822545 AGTGAGTTACGATCACATCATGG + Intergenic
1084866344 11:72061178-72061200 AGTGAGCTATGATCACACCACGG + Intronic
1085122574 11:73976671-73976693 GGTGACCTATGACCTCATCAAGG - Exonic
1085733964 11:79023249-79023271 GGTGAATTATATTCAAATCAAGG + Intronic
1088248694 11:107843786-107843808 AGTGAACTATGATCACACCATGG + Intronic
1089374436 11:117984615-117984637 GTTGAAGTATGATAACATCAAGG - Intergenic
1089747249 11:120625988-120626010 GCTGAGGTAGGATTACATCAAGG + Intronic
1091688921 12:2582848-2582870 GGTGATGTATGATGGGATCATGG + Exonic
1092570488 12:9716045-9716067 GGTGAACTAAGAACACATGATGG - Intronic
1092603318 12:10091000-10091022 GGTCAAGCTTGATCAGATCAAGG - Intronic
1093485521 12:19647930-19647952 GATTGAGTATGATCACCTCAGGG + Intronic
1094267970 12:28580424-28580446 GGAGATGTTTGATCACCTCACGG + Intergenic
1094572216 12:31651070-31651092 ACTTAAGTATGATAACATCAAGG + Intronic
1095314411 12:40742594-40742616 AGTGAGCTATGATCACACCATGG - Intronic
1095588722 12:43879033-43879055 TGTCAAGCATGATCAGATCAGGG + Intronic
1096730669 12:53609587-53609609 AGTGAGCTATGATCACACCACGG + Intronic
1096752964 12:53774435-53774457 GGTGAAGTGTCATCTCAGCAAGG + Intergenic
1102063192 12:109950830-109950852 AGGGAAGGATGATCACACCATGG - Intronic
1104702722 12:130919301-130919323 GGGGAAGTATGATTTCATCATGG - Intergenic
1104702750 12:130919550-130919572 GGGGAAGTATGATTTCATCATGG - Intergenic
1105602948 13:21903163-21903185 ATTGAAGTATGATAACATCAAGG + Intergenic
1106453326 13:29904441-29904463 GGTGAAAAATGCTCACACCAAGG - Intergenic
1107205774 13:37785635-37785657 GGTGAATTATGATTCAATCAAGG + Intronic
1107909809 13:45095227-45095249 AGTGAGCTATGATCGCATCACGG + Intergenic
1109202191 13:59442973-59442995 GGTAAATTATGTTCACATTATGG + Intergenic
1110106814 13:71687662-71687684 AGTGAGCTGTGATCACATCACGG - Intronic
1110299138 13:73905362-73905384 GTTGAAATATGATATCATCATGG + Intronic
1110923886 13:81125921-81125943 GGATAAGTGGGATCACATCAAGG - Intergenic
1113127962 13:107000992-107001014 AGTGAGGTGTGATCACACCACGG - Intergenic
1114061235 14:19017498-19017520 GGTGAATTATGATCAAACCACGG - Intergenic
1114101017 14:19382488-19382510 GGTGAATTATGATCAAACCACGG + Intergenic
1115383399 14:32766546-32766568 GGTGAAGTAATATCTAATCATGG + Intronic
1116266485 14:42698075-42698097 GGTGCAGTTTGATCACATTAGGG + Intergenic
1116896648 14:50322511-50322533 GGTGGATTATGATCGCATCAGGG + Exonic
1117028813 14:51649813-51649835 AGTGAATTATGATTACACCACGG - Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1120198368 14:81512192-81512214 GGTGAGGTCTGTCCACATCATGG - Intronic
1120795744 14:88631268-88631290 GGTGTGTCATGATCACATCATGG - Intronic
1121761302 14:96447369-96447391 AGTGAGCTATGATCACACCACGG - Intronic
1122334166 14:100957403-100957425 GGTGAAGCATCATCAAATTATGG + Intergenic
1123179481 14:106455267-106455289 GGTAAAGGATGATTAGATCATGG - Intergenic
1124453046 15:29815658-29815680 GGTGAATTTTTATCATATCAGGG + Intronic
1124992390 15:34688347-34688369 ATTGAAGTATGATAGCATCAAGG + Intergenic
1125271191 15:37940461-37940483 GCTCAAGTATCATCACATCAGGG + Intronic
1125458786 15:39888483-39888505 GGTGAGTTATGATCACAGCATGG - Intronic
1125831906 15:42722796-42722818 GGAGAAGTATGATCACAAGGTGG + Intergenic
1129271225 15:74420279-74420301 GGTGAAGAATGCTCACTTCCGGG - Intronic
1131834136 15:96373443-96373465 GGTGAAGTAGGAGCAGAGCAAGG + Intergenic
1132214291 15:100051290-100051312 GCTGATGTATGATTACATCTCGG - Intronic
1132227555 15:100154230-100154252 GGTGAAGTGAAATAACATCAAGG + Intronic
1132441211 15:101866382-101866404 GTTATAGTATGACCACATCAAGG - Intergenic
1133575462 16:7084782-7084804 GGGGGAATATGAACACATCATGG - Intronic
1134361256 16:13533096-13533118 GGAGAAGAATGATCAGATGAAGG - Intergenic
1135534804 16:23285227-23285249 AGTGAGCAATGATCACATCATGG - Intronic
1136869747 16:33795657-33795679 GGTAAAGTATGATCAAATACAGG - Intergenic
1140405381 16:74707140-74707162 AGTGAGCTATGATCACACCACGG - Intergenic
1141076911 16:81015040-81015062 GGTGAATTATTTTCACCTCAAGG + Intronic
1141343199 16:83222560-83222582 GGTGTAGTACAATCCCATCAAGG - Intronic
1203102425 16_KI270728v1_random:1320398-1320420 GGTAAAGTATGATCAAATACAGG + Intergenic
1142701496 17:1664789-1664811 GGTGAAATATGAACTCATAAGGG + Intronic
1143702551 17:8672012-8672034 GGTGAACCAAGATCACACCACGG + Intergenic
1143751564 17:9032025-9032047 GGTGAAATATGTTTCCATCAAGG + Intronic
1143880906 17:10029386-10029408 GGTGAAGAATGACGAAATCACGG + Intronic
1144381965 17:14708410-14708432 TTTGAAGTATGGTAACATCAAGG + Intergenic
1145000320 17:19300337-19300359 TTTGAAGTATGATAACATTAAGG + Intronic
1145968928 17:28943100-28943122 CGTGAAGTAGTATCACATTATGG - Intronic
1146283073 17:31557948-31557970 AGTGAATTATGATCGCACCACGG - Intergenic
1146317280 17:31818030-31818052 AGTGAGCTATGATCACACCATGG - Intergenic
1146405584 17:32534221-32534243 AGTGAGCTATGATCACACCACGG - Intronic
1149332284 17:55596539-55596561 ACTGAAGTATGATAACATCAAGG - Intergenic
1150037815 17:61823033-61823055 AGTGAAGTAGGCACACATCAGGG - Intronic
1150422473 17:65050672-65050694 AGTGAGCTATGATCACAACAGGG + Intronic
1150672013 17:67208882-67208904 GGTGAGCTGTGATCACACCATGG + Intronic
1151134266 17:71930681-71930703 AGTGAAATATGATGGCATCACGG - Intergenic
1151525102 17:74659750-74659772 GGTGCAGAAAGATCATATCATGG - Intergenic
1153459047 18:5313530-5313552 GATGGAATATGATCATATCAAGG - Intergenic
1157275277 18:46306069-46306091 AGTGAGCTATGATCACACCAAGG - Intergenic
1158153035 18:54393831-54393853 GGAGAAGTAAGATCAAATCAGGG + Intergenic
1158339603 18:56450983-56451005 GGTGATGTGTGATCCCATTATGG + Intergenic
1160643767 19:167078-167100 GTTATAGTATGACCACATCAAGG + Intergenic
1161075545 19:2283431-2283453 AGTGAGCTATGATCACACCACGG - Intronic
1162301241 19:9846343-9846365 GGGGAAGAATGATGACAGCAAGG + Intronic
1162377623 19:10314509-10314531 AGTGAGGTATGATTGCATCATGG + Intronic
1164391111 19:27822177-27822199 GAAGCAGTCTGATCACATCATGG + Intergenic
1164620419 19:29692603-29692625 GTTGAAGTAGGATAACATCAAGG - Intergenic
1165687622 19:37835817-37835839 AGTGAGCTATGATCACACCATGG - Intergenic
1167194443 19:48017838-48017860 AGTGAGCTATGATCACATCATGG + Intronic
1167325203 19:48820098-48820120 AATGAACTATGATCACACCATGG + Intronic
1168218591 19:54944356-54944378 GTTTATGTATGAGCACATCAAGG + Intronic
925277469 2:2660708-2660730 AGTGAAAGATGATCAGATCATGG - Intergenic
926471145 2:13259797-13259819 GGTGAAATAGGATGACATAAAGG + Intergenic
928001963 2:27531277-27531299 AGTGCAGAATAATCACATCATGG - Intergenic
928586676 2:32766234-32766256 GTTGTATTATGATCAAATCAGGG + Intronic
931880108 2:66559851-66559873 AGTGAATCATGATCACACCATGG - Intronic
932015487 2:68022712-68022734 GGACAAGTGGGATCACATCAAGG - Intergenic
932191860 2:69747740-69747762 GGTGAGCTATGATTACACCAGGG - Intronic
932803863 2:74766530-74766552 TGTGAAATATAAGCACATCATGG - Intergenic
933811922 2:86037980-86038002 GGTGAAGTGTGAACACAAAAAGG - Intronic
936480088 2:112877844-112877866 GGTGAAGTTTGACCTCATGATGG + Intergenic
939341533 2:140901500-140901522 GATGCAGAATAATCACATCAGGG + Intronic
939928797 2:148206400-148206422 AGTGAATAATGATCAAATCAGGG + Intronic
941126686 2:161592460-161592482 AGTGAGCTATGATCACACCACGG - Intronic
941148246 2:161880821-161880843 GGTGAACTATGAGCAAATGATGG + Intronic
943305977 2:186263369-186263391 AGTGAGCTATGATCACACCATGG + Intergenic
946287266 2:218713332-218713354 AGTGAGCTATGATCACACCATGG - Intronic
946743497 2:222823192-222823214 ACTGAAGTATGATAACATCAAGG + Intergenic
947906064 2:233764151-233764173 GGTGAAGTCTCATCAGAACAGGG + Intronic
1174084255 20:47994194-47994216 ATTGAAGTAAGATAACATCAAGG - Intergenic
1174432767 20:50482685-50482707 GTTGAAGTAAGATAACATCAAGG - Intergenic
1174510465 20:51047608-51047630 GTTGAAGTAAGATAACATCGAGG + Intergenic
1175347448 20:58290722-58290744 AGTGAACTATGATCACAGCATGG + Intergenic
1177167106 21:17614684-17614706 AGTGAGCTATGATAACATCATGG + Intergenic
1177399242 21:20580836-20580858 ATTGAAGTATGATAAAATCAAGG + Intergenic
1178080517 21:29058968-29058990 AGTGAGCTGTGATCACATCATGG - Intronic
1178834281 21:36083450-36083472 GGTCAAGGAAGAACACATCAGGG + Intergenic
1178892249 21:36530025-36530047 GGTGAAGCATAAGCAAATCATGG - Intronic
1180479720 22:15740110-15740132 GGTGAATTATGATCAAACCACGG - Intergenic
1181384496 22:22534001-22534023 AGTGAACTGTGATCACACCATGG - Intergenic
1181750735 22:24987521-24987543 AGTGAGCTATGATCACACCATGG - Intronic
950606041 3:14081141-14081163 AGTGAGGTATGATCACACCATGG + Intronic
956307255 3:67839181-67839203 GGTGAACTATGAGAAGATCATGG - Intergenic
957228904 3:77485971-77485993 GGTAACATATGAACACATCAGGG - Intronic
959080794 3:101798990-101799012 AGTGAGCTATGATCACACCATGG - Intronic
959226324 3:103591196-103591218 GTTGAAATAGAATCACATCAAGG - Intergenic
959530947 3:107433028-107433050 GAGGAAGTTTGATTACATCAAGG - Intergenic
961228642 3:125279473-125279495 GGTTAAGTAAGATCTCATCACGG + Intronic
962353150 3:134670578-134670600 AGTGAAGTCTGATGACACCATGG + Intronic
964074740 3:152680083-152680105 GCTGAAGAATTATCACATAAAGG - Intergenic
965931394 3:174047179-174047201 GGTGAATTATGATAAATTCATGG - Intronic
967641380 3:191868688-191868710 TGTGAAGTAGCATCTCATCATGG - Intergenic
970506650 4:16737283-16737305 AGTGAGCTATGATCACACCACGG - Intronic
971339532 4:25755138-25755160 AGTGAGCTATGATCACACCATGG - Intronic
971978119 4:33717352-33717374 TGTGAAGTAATATCTCATCATGG + Intergenic
973615093 4:52670310-52670332 ATTGAAGTATTATAACATCAAGG + Intergenic
974311365 4:60214553-60214575 AGTGAGCTATGATCACACCACGG - Intergenic
976804192 4:89027451-89027473 AATGAGTTATGATCACATCATGG + Intronic
977077734 4:92478652-92478674 ATAGAAGTATGATCACAGCATGG - Intronic
977867666 4:102049359-102049381 GGTCAAGTTTGTTCACATCTTGG + Intronic
978443202 4:108756419-108756441 GGTCAAGAGTGATCACATCCTGG + Exonic
978710765 4:111778189-111778211 GCTGAAATATGCTCCCATCAGGG - Intergenic
979357732 4:119725239-119725261 CGTGAACTATGATCACGCCATGG + Intergenic
980711989 4:136581044-136581066 ATTGAAGTATGATAACATCAAGG - Intergenic
981976578 4:150737159-150737181 AGTGAGCTATGATCACACCATGG + Intronic
982251235 4:153408211-153408233 AGTGAGCTATGATCACACCATGG + Intronic
982745286 4:159100107-159100129 AGTGAGCTATGATCACACCATGG - Intergenic
982986264 4:162211197-162211219 CGTGAAGTATTATTACATGAGGG - Intergenic
983170072 4:164525770-164525792 ATTGAAGTATGATAACATCAAGG - Intergenic
984016400 4:174432185-174432207 ATTGAAGTGTGATAACATCAAGG - Intergenic
988738947 5:34050630-34050652 AGTGAGGTATGATAACATCAAGG - Intronic
990524575 5:56612249-56612271 AGTGAATAATAATCACATCATGG - Intergenic
991717406 5:69464626-69464648 GGTGAGCTATGATCACACCACGG + Intergenic
992506518 5:77392493-77392515 ACTGAAGTATGATAACATCAAGG + Intronic
995250323 5:109985653-109985675 GGTGAAAAATGATCGGATCATGG - Intergenic
995348525 5:111148701-111148723 ATTCAAGTATGATAACATCAAGG - Intergenic
996795648 5:127343648-127343670 GGTGAAGAATGATCTTCTCAGGG + Intronic
998260475 5:140627387-140627409 GTTGAACAATGATCATATCAAGG + Intergenic
1001056127 5:168451646-168451668 AGTGAGCTATGATCACACCATGG + Intronic
1002003593 5:176214195-176214217 AGTGAGCTATGATCACACCACGG + Intergenic
1002285393 5:178159418-178159440 AGCAAAGTATGATAACATCAAGG + Intergenic
1002733155 5:181357703-181357725 GTTATAGTATGACCACATCAAGG - Intergenic
1002751384 6:116405-116427 GTTATAGTATGACCACATCAAGG + Intergenic
1004315163 6:14580513-14580535 ATTGAAGTATGATAACATCAAGG - Intergenic
1004920668 6:20372521-20372543 ATTGAAGTATGATAACATCAAGG + Intergenic
1005157449 6:22823154-22823176 AGTGAAGTCTGATGGCATCATGG - Intergenic
1006290711 6:33134014-33134036 GGTGAAAGCTGTTCACATCAAGG + Intergenic
1007135828 6:39521168-39521190 GATGAAGTCTGATTACATTATGG + Intronic
1007843063 6:44732306-44732328 GTTGAAGTATGATAACATCAAGG + Intergenic
1008833575 6:55799677-55799699 ATTGAAGTATGATAACATAAAGG - Intronic
1008893725 6:56527039-56527061 CTTGAAGTATGATCACATGTGGG - Intronic
1010140098 6:72603651-72603673 AGTGAAATATTATCTCATCATGG + Intergenic
1013272384 6:108557269-108557291 GGTGATGTATGACCACAACTCGG - Intergenic
1013565801 6:111360530-111360552 AGTGAACTATGATCACACCATGG - Intronic
1015258414 6:131206692-131206714 AGTGAAGAAAGATGACATCAGGG - Intronic
1015812076 6:137170788-137170810 ATTGAAGTATCATAACATCAAGG + Intronic
1016324712 6:142887403-142887425 GGTGAAACATGATCATTTCAGGG - Intronic
1016360946 6:143266882-143266904 TGTGAACTATGATCACACCATGG + Intronic
1017701290 6:157074835-157074857 GGTGAGGTATAGTAACATCATGG + Intronic
1018090415 6:160342050-160342072 GGTGAAGATTGGTCACATCAGGG + Intergenic
1019140133 6:169937682-169937704 GGTGAAGGGTGCTCACTTCAAGG + Intergenic
1019719632 7:2560190-2560212 AGTGAACTGTGATCATATCACGG + Intronic
1021920624 7:25481450-25481472 AGTGAGCTATGATCACACCACGG - Intergenic
1022750819 7:33223047-33223069 CCTGAAGTAAGATCAGATCAGGG - Intronic
1023398424 7:39773259-39773281 AGTGAGCTATGATCACATCACGG - Intergenic
1025134231 7:56397231-56397253 AGTGAGCTATGATCACATCACGG + Intergenic
1026183936 7:68066509-68066531 GGACAAGTTTGATCACTTCAGGG + Intergenic
1026613745 7:71883714-71883736 ATTGAAATACGATCACATCAAGG - Intronic
1027796326 7:82698219-82698241 AGTGAGGTATGATCACACCACGG + Intergenic
1028424601 7:90672574-90672596 AGTGAGCTATGATCACACCATGG - Intronic
1029159561 7:98541825-98541847 AGTGAGCTATGATCACACCACGG + Intergenic
1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG + Intronic
1029416106 7:100444227-100444249 AGTGAGTTATGATCACACCACGG + Intergenic
1029900364 7:104032762-104032784 ATTGAAGTATGATAACGTCAAGG + Intergenic
1031397925 7:121294627-121294649 ACTGAAGTATGATAACATCAAGG + Intronic
1031566507 7:123304426-123304448 GATGTATAATGATCACATCAGGG - Intergenic
1033187776 7:139244988-139245010 AGTGAGCTATGATCACATCACGG - Intronic
1034632378 7:152540621-152540643 ACTGAAGTATGATGACCTCAAGG - Intergenic
1035510362 8:176587-176609 GTTATAGTATGACCACATCAAGG + Intergenic
1041670514 8:60487142-60487164 AATAAAGTATGATAACATCAAGG - Intergenic
1042670747 8:71260828-71260850 TGTTAAGTATGCTCAAATCAAGG + Intronic
1044430875 8:92104178-92104200 GGTCAAATATGATCAGATAATGG + Intergenic
1044994121 8:97822766-97822788 AGTGCAGAATAATCACATCATGG + Intronic
1052682109 9:31706707-31706729 AGTTAGCTATGATCACATCATGG - Intergenic
1053259711 9:36651745-36651767 GTGGCAGTATGATCACCTCACGG + Exonic
1055638637 9:78301577-78301599 TGTGAAGTGAGATCACAGCATGG + Intronic
1057215435 9:93225337-93225359 AGTGAGCTATGATCACACCACGG + Intronic
1058275308 9:103033894-103033916 AGTGAAGTATGAGTACATTATGG + Intergenic
1059807201 9:117815290-117815312 GGAGAAGTAGGAGCAGATCACGG - Intergenic
1062757560 9:138310025-138310047 GTTATAGTATGACCACATCAAGG - Intergenic
1185516626 X:703954-703976 GGGGAAAGATGATGACATCATGG + Intergenic
1189582602 X:42423108-42423130 TGGTAAGTATGATAACATCAAGG + Intergenic
1192955451 X:76065134-76065156 GGTGAAAGATGATGAAATCATGG - Intergenic
1193178083 X:78419150-78419172 TGTGAAGTGGTATCACATCATGG - Intergenic
1193662366 X:84273021-84273043 GGTCAAGTGTGTTCACACCAGGG + Intergenic
1194049122 X:89046586-89046608 GGCCAAGAATGATCAGATCAAGG - Intergenic
1194356330 X:92888964-92888986 TTTAAAGTATGATAACATCAAGG - Intergenic
1196395350 X:115255525-115255547 AATGAGCTATGATCACATCACGG + Intergenic
1197079802 X:122398404-122398426 GCTGAAGACGGATCACATCATGG + Intergenic
1197209707 X:123818783-123818805 ACTGAAGTATGATAACATCAAGG - Intergenic
1199293656 X:146133200-146133222 AGTGAAGTAGTATCACATTATGG + Intergenic
1199313287 X:146346720-146346742 TGTGAAGTATAATTACATAAAGG + Intergenic
1200664675 Y:6005964-6005986 TTTAAAGTATGATAACATCAAGG - Intergenic