ID: 1029405860

View in Genome Browser
Species Human (GRCh38)
Location 7:100373726-100373748
Sequence TACCCAGGACCACCCAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029405855_1029405860 15 Left 1029405855 7:100373688-100373710 CCTTGCTGCTGCCGCCAGCATTT 0: 1
1: 0
2: 0
3: 18
4: 223
Right 1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG 0: 1
1: 0
2: 0
3: 43
4: 153
1029405854_1029405860 16 Left 1029405854 7:100373687-100373709 CCCTTGCTGCTGCCGCCAGCATT 0: 1
1: 0
2: 1
3: 17
4: 200
Right 1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG 0: 1
1: 0
2: 0
3: 43
4: 153
1029405856_1029405860 4 Left 1029405856 7:100373699-100373721 CCGCCAGCATTTCTGCAGCCTAG 0: 1
1: 1
2: 1
3: 44
4: 654
Right 1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG 0: 1
1: 0
2: 0
3: 43
4: 153
1029405857_1029405860 1 Left 1029405857 7:100373702-100373724 CCAGCATTTCTGCAGCCTAGTGA 0: 1
1: 1
2: 0
3: 9
4: 161
Right 1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG 0: 1
1: 0
2: 0
3: 43
4: 153
1029405851_1029405860 25 Left 1029405851 7:100373678-100373700 CCCCTACTGCCCTTGCTGCTGCC 0: 1
1: 0
2: 5
3: 55
4: 541
Right 1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG 0: 1
1: 0
2: 0
3: 43
4: 153
1029405852_1029405860 24 Left 1029405852 7:100373679-100373701 CCCTACTGCCCTTGCTGCTGCCG 0: 1
1: 0
2: 0
3: 30
4: 270
Right 1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG 0: 1
1: 0
2: 0
3: 43
4: 153
1029405853_1029405860 23 Left 1029405853 7:100373680-100373702 CCTACTGCCCTTGCTGCTGCCGC 0: 1
1: 0
2: 2
3: 42
4: 414
Right 1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG 0: 1
1: 0
2: 0
3: 43
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029405860 Original CRISPR TACCCAGGACCACCCAGATG TGG Intronic
901022554 1:6262450-6262472 TAACCAGGACCACCTGGAGGGGG - Intergenic
901451540 1:9339306-9339328 CACCCGAGACCACCCACATGTGG - Intronic
902338662 1:15768444-15768466 TACCTGTTACCACCCAGATGAGG + Intronic
903370950 1:22835833-22835855 TGCCCAGGACAGCCCTGATGGGG + Intronic
903676714 1:25068919-25068941 CACTGAGGACCAACCAGATGGGG + Intergenic
906655595 1:47546126-47546148 TGCACAGGAACACCCAGCTGAGG + Intergenic
906663089 1:47596391-47596413 TGCCCAGGCCCAGCCAGGTGAGG - Intergenic
907456790 1:54581409-54581431 GGCCCAGGGCCACCCAGCTGCGG - Intronic
909745432 1:79090621-79090643 TACCCAGTACCAGCAAGCTGAGG + Intergenic
914751408 1:150537561-150537583 TGAACAGGACCACCCAGAGGAGG + Intergenic
915099036 1:153485352-153485374 TTCTAAGGACCACCCAGGTGAGG - Intergenic
920646991 1:207811146-207811168 GTCCCAGGCCCAGCCAGATGGGG - Intergenic
922225479 1:223642440-223642462 TTCCCATGACGACCCAGAAGGGG + Intronic
1063189248 10:3678517-3678539 GACCCAGGACCACCCAGGGGAGG + Intergenic
1067527922 10:47049506-47049528 AACCCAGGACCACCAGGCTGTGG - Intergenic
1067569030 10:47358353-47358375 TGCCCAGAACCACTCAGCTGGGG - Intergenic
1067794492 10:49311047-49311069 TCCCCAGGACCACCAAGACCCGG + Intronic
1077161269 11:1113686-1113708 GACCCAGGAGGACCCAGCTGGGG - Intergenic
1077930250 11:6723904-6723926 TTCCCAGGACCACACAGAAGTGG + Intergenic
1080790808 11:35520926-35520948 TAGCCAGTATAACCCAGATGTGG + Intronic
1083400336 11:62418976-62418998 TAGGCAGCAGCACCCAGATGGGG - Intronic
1084215714 11:67645856-67645878 CACCCCGGACGACCCATATGAGG - Exonic
1084287399 11:68141110-68141132 TGCCCAGGACCACACGCATGAGG + Intergenic
1084328239 11:68414230-68414252 TGCCCAGGACCTTCCAGCTGAGG - Intronic
1085862263 11:80247896-80247918 AACCCAGGAGCAGGCAGATGCGG - Intergenic
1088653208 11:111976651-111976673 AGCCCAGGAGCCCCCAGATGTGG + Intronic
1089895805 11:121929095-121929117 GACCCAGGACGCCCCAGATTTGG + Intergenic
1090276779 11:125425802-125425824 CTCCCATGACCACTCAGATGTGG + Intronic
1091234162 11:134008618-134008640 TGCTCAGAACCACCCAGCTGGGG + Intergenic
1096345451 12:50842537-50842559 TATTCAGGACCATCCAGATAGGG + Intergenic
1096428167 12:51521474-51521496 CACCCAGGTCCAATCAGATGTGG + Intergenic
1100352482 12:93797602-93797624 TACCAGGTACCACCAAGATGTGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102824374 12:115935396-115935418 TACCCAAGGTCACCTAGATGTGG - Intergenic
1102866343 12:116378097-116378119 CACCCAGCACGACGCAGATGTGG + Intergenic
1103514177 12:121496182-121496204 GCCCCAGGACCACCCACATAGGG + Intronic
1103879438 12:124154721-124154743 GTCCCAGGCCCGCCCAGATGGGG + Intronic
1104042738 12:125141116-125141138 TACCCAGCATCCCCCAGATGGGG + Intronic
1107935673 13:45343246-45343268 TACCCCGCCCCGCCCAGATGGGG + Intergenic
1108594158 13:51935930-51935952 TTCCCAGAACCACCCACAGGTGG + Intronic
1114646431 14:24258988-24259010 TACCCAGCCCTGCCCAGATGTGG - Intronic
1115524482 14:34266288-34266310 TACCCGGGACAACCCTGCTGAGG - Intronic
1118730233 14:68660885-68660907 AACCCAGGACCACCAAAATGAGG + Intronic
1121034635 14:90690655-90690677 TACCCATGATCAGCCAGAGGTGG + Intronic
1122853272 14:104548057-104548079 CACTCAGGAAGACCCAGATGGGG + Intronic
1122941197 14:104982160-104982182 TTCCCTGGACCACTGAGATGGGG + Intergenic
1125610237 15:40964566-40964588 TACCCCTGACCACCTAGATCTGG + Intergenic
1131676953 15:94680413-94680435 TAACCAGCAGCACCCAGTTGCGG + Intergenic
1132871546 16:2117740-2117762 TCCCCAGGGCCATCCAGATGGGG - Intronic
1134520983 16:14919155-14919177 TCCCCAGGGCCATCCAGATGGGG + Intronic
1134550589 16:15136818-15136840 TCCCCAGGGCCATCCAGATGGGG - Intronic
1134708659 16:16317806-16317828 TCCCCAGGGCCATCCAGATGGGG + Intergenic
1134715872 16:16357839-16357861 TCCCCAGGGCCATCCAGATGGGG + Intergenic
1134950945 16:18350839-18350861 TCCCCAGGGCCATCCAGATGGGG - Intergenic
1134958884 16:18394320-18394342 TCCCCAGGGCCATCCAGATGGGG - Intergenic
1135136636 16:19889675-19889697 TACCCAGTCCCAGCCACATGTGG - Intergenic
1135943409 16:26842454-26842476 TGCCCAGGACCCCTCAGAGGTGG - Intergenic
1138089490 16:54162603-54162625 TACCCAGTCTCAGCCAGATGTGG - Intergenic
1141134857 16:81458497-81458519 TACGCAGGAGCACCCAGTGGAGG - Intronic
1141834239 16:86528279-86528301 TGGCCAGGCTCACCCAGATGGGG + Intergenic
1142304471 16:89277860-89277882 TACCCAGCACCCCCCTGGTGAGG - Intronic
1144365973 17:14545327-14545349 CAGCCAGGACCACACAGCTGTGG + Intergenic
1145797797 17:27666090-27666112 TATCCAGGCCCACCCAGCTGAGG + Intergenic
1145812245 17:27771426-27771448 TATCCAGGCCCACCCAGCGGAGG + Intronic
1146278612 17:31530919-31530941 AACCCAGGACCACCCAGCTAGGG + Intronic
1146842277 17:36164315-36164337 TATCCAGGCCCACCCAGCTGAGG + Intergenic
1146854587 17:36252274-36252296 TATCCAGGCCCACCCAGCTGAGG + Intronic
1146866033 17:36336102-36336124 TATCCAGGCCCACCCAGCTGAGG - Intronic
1146870487 17:36376166-36376188 TATCCAGGCCCACCCAGCTGAGG + Intronic
1146877845 17:36427247-36427269 TATCCAGGCCCACCCAGCTGAGG + Intronic
1147068902 17:37936714-37936736 TATCCAGGCCCACCCAGCTGAGG - Intergenic
1147073370 17:37976790-37976812 TATCCAGGCCCACCCAGCTGAGG + Intergenic
1147080426 17:38016251-38016273 TATCCAGGCCCACCCAGCTGAGG - Intronic
1147084892 17:38056328-38056350 TATCCAGGCCCACCCAGCTGAGG + Intronic
1147096373 17:38140211-38140233 TATCCAGGCCCACCCAGCTGAGG - Intergenic
1147100839 17:38180294-38180316 TATCCAGGCCCACCCAGCTGAGG + Intergenic
1147612008 17:41807373-41807395 TTCCCAGGACCACACAGCAGTGG + Intronic
1147946293 17:44082117-44082139 TACCCAAGGCCACTCAGCTGGGG - Intronic
1148873918 17:50675523-50675545 TCCCCAGGCCCTGCCAGATGGGG + Intronic
1149845432 17:60006758-60006780 TATCCAGGCCCACCCAGCTGAGG + Intergenic
1150083780 17:62263341-62263363 TATCCAGGCCCACCCAGCTGAGG + Intergenic
1151724287 17:75875583-75875605 GAGCAAGCACCACCCAGATGTGG + Intronic
1152438831 17:80292764-80292786 AGCCCAGGACCCCCCAGGTGAGG - Intronic
1152561260 17:81079888-81079910 TACCCAGGCCCACCCTGCTGAGG - Intronic
1152822165 17:82442888-82442910 TACCCAGGTCCTCCCAGGTGCGG - Exonic
1153501598 18:5755434-5755456 TATCCAGCCCCACCCATATGGGG - Intergenic
1153524580 18:5982360-5982382 TTCCCAGGTCTACCCAGCTGTGG + Intronic
1157319662 18:46624386-46624408 TACTCAAGCCCACACAGATGTGG + Intronic
1160752936 19:743242-743264 TTCCCAGGGCCACACAGCTGGGG - Intronic
1160774411 19:848426-848448 TGCCCAGGGCCACCCTGATGGGG - Intergenic
1162362116 19:10226800-10226822 CAGCCAGGACCTCCCAGATGGGG - Intronic
1164662465 19:29988576-29988598 TACACAGAACCACCTGGATGAGG - Intronic
1165603189 19:37076230-37076252 GACCCAGAATCACACAGATGCGG + Intronic
1166500526 19:43337729-43337751 TCCCCTGCACCACCAAGATGAGG - Intergenic
1166505058 19:43365783-43365805 TTCCCAGGAGCTCACAGATGTGG + Intergenic
1166505481 19:43369131-43369153 TTCCCAGGAGCTCACAGATGTGG - Intergenic
1166509597 19:43395970-43395992 TCCCCTGCACCACCAAGATGAGG + Intergenic
924969728 2:114795-114817 CCTCCAGGACCACCCAGCTGAGG - Intergenic
925166826 2:1720843-1720865 CACCCAGGTCCAACCAGCTGCGG - Intronic
926975761 2:18515265-18515287 TCCCCAGGCCAACCCTGATGGGG + Intergenic
927256610 2:21045019-21045041 AACCCAGGATCACTCAGAAGGGG + Intergenic
932806613 2:74789819-74789841 GACCCAGGACCATACAGGTGAGG + Intergenic
935087471 2:99862110-99862132 TACCCAGGATCACAATGATGAGG - Intronic
935974137 2:108560547-108560569 TACGGAGGACCTCCCAGAGGAGG - Intronic
937310045 2:120896433-120896455 TAGCCAGGCCCACCAAGCTGGGG + Intronic
937983342 2:127627553-127627575 AACCCAGGTCCACCCGGAAGGGG + Intronic
938141423 2:128797904-128797926 TACCCAGGACCACGGAGAGGGGG - Intergenic
938790262 2:134669989-134670011 GGGCCAGAACCACCCAGATGAGG + Intronic
941567402 2:167126460-167126482 TACACAGGAGCATACAGATGAGG + Intronic
946428181 2:219610863-219610885 TGCCCAGGACCATACAGCTGGGG - Intronic
949076385 2:242061400-242061422 TCCCCAGAGGCACCCAGATGGGG + Intergenic
1170213353 20:13867576-13867598 TGCCCAGGATCACACAGTTGTGG - Intronic
1170573502 20:17646140-17646162 TGCCCAGGACCACCCAGCTCAGG - Intronic
1171204700 20:23269829-23269851 TGCCCAGGACCCCACAGTTGTGG - Intergenic
1172895401 20:38296367-38296389 TACCCTGGCCACCCCAGATGGGG + Intronic
1173013254 20:39201377-39201399 TGCCCAGCACGACCCAGAGGAGG - Intergenic
1175148617 20:56915407-56915429 CCACCTGGACCACCCAGATGAGG + Intergenic
1177920991 21:27152411-27152433 TACCCAGGGCTGCCAAGATGTGG + Intergenic
1178417884 21:32418625-32418647 TGCCCAAGACCACCCAGCTAGGG + Intronic
1180155529 21:45975452-45975474 TACCCAGGGCACCCGAGATGTGG - Intergenic
1182094497 22:27616761-27616783 GACCCAGCAGCACCCAGCTGAGG - Intergenic
1183373302 22:37447965-37447987 TCCCCAGGATCACACAGCTGGGG + Intergenic
1183706755 22:39479053-39479075 GACCCAGGACCGGCCAGAGGCGG + Intronic
1184151766 22:42643653-42643675 TGCCCAGGGCCACCCAGCTGGGG + Intronic
1184878729 22:47291739-47291761 TGCCCAGGACCCCCCAGCTTAGG - Intergenic
1185194174 22:49458146-49458168 TACCAAGGGCCAAGCAGATGTGG - Intronic
950443865 3:13024964-13024986 TACCCAGGGTCACACAGTTGTGG - Intronic
950839744 3:15956150-15956172 TAGCCAAGAGCACCCAGCTGAGG + Intergenic
953372957 3:42405779-42405801 TGCCCAAGACCACACAGCTGTGG - Intronic
954698516 3:52440032-52440054 CACCAAGGACTACCCAGATGAGG - Exonic
955141536 3:56274526-56274548 TACACAGGTCCACTCATATGTGG - Intronic
956182059 3:66526742-66526764 TGCCCAGGTCCACTCAGCTGAGG + Intergenic
960749307 3:120928887-120928909 TAACAAAGACCACCCAAATGAGG + Intronic
960936966 3:122910439-122910461 TGCCCAGTTCCACCCAGCTGAGG + Intronic
961109676 3:124273215-124273237 TCCCCAGCACCTCCAAGATGGGG - Intronic
961324756 3:126103520-126103542 CACCCAGGAACACCCACAGGTGG + Intergenic
961816066 3:129551033-129551055 TACCCAGAGCCACCCAGAGCTGG + Intronic
963274074 3:143313411-143313433 TACCCAGGACCAGCCAGTTTTGG + Intronic
969597360 4:8157013-8157035 TACCGAGGGCCTCCCAGGTGTGG + Intronic
971302712 4:25455225-25455247 TCCTCAGGAGCACCAAGATGAGG - Intergenic
971522185 4:27567994-27568016 TTCCCAGTGCCACCCAGAAGTGG - Intergenic
973181456 4:47273735-47273757 TACACAGGAGAACACAGATGAGG + Intronic
976264761 4:83180072-83180094 TAACCAGGACCAGCCAGGCGCGG - Intergenic
983676257 4:170296975-170296997 TATCCAAGACCACCAAGGTGGGG + Intergenic
983942833 4:173554024-173554046 TACTCACTACCACCCAGGTGAGG - Intergenic
985699563 5:1362278-1362300 TACGCAGGAACATCCAGATGTGG - Intergenic
988903898 5:35764529-35764551 GACCCAGGACCTGGCAGATGAGG - Intronic
990677647 5:58205679-58205701 TACCCAGAACCACAGAGAAGGGG + Intergenic
991964380 5:72076682-72076704 TACCCAGAACAATTCAGATGAGG - Intergenic
997719288 5:136065136-136065158 TGCCCAGGAGCTCCCAGAAGTGG + Intergenic
998033133 5:138890507-138890529 TAATCAGGACCAGCCAAATGAGG + Intronic
998807539 5:145933581-145933603 TCCCCAACACCACCCACATGAGG - Intergenic
1002372723 5:178767906-178767928 CACCCAGCATCCCCCAGATGTGG - Intergenic
1006108509 6:31730371-31730393 TGCCCAGGCCCACCCAGATCTGG + Intronic
1015735609 6:136396682-136396704 TACCCAGGACCAAACAGTTATGG - Intronic
1018092675 6:160358640-160358662 TCCCCAGAGCCACCCGGATGGGG - Intronic
1018916296 6:168134567-168134589 GACCCAGGAGCACCCAGGGGAGG + Intergenic
1019280224 7:195990-196012 CCCCCGGGACCACCCAGGTGAGG - Intronic
1019789874 7:3004221-3004243 GATCCAGGACCACCCAGAGTGGG + Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1029403287 7:100358372-100358394 TACCCAGGACCGCCCAGGTATGG + Intronic
1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG + Intronic
1029548765 7:101225261-101225283 CACCCAGGGCCACCCAGACCAGG - Intergenic
1032020802 7:128406258-128406280 CACCCAGGACCCCCCAGCAGAGG + Intronic
1033259035 7:139826334-139826356 CAGCCAGGAGCAGCCAGATGGGG + Intronic
1033551917 7:142455188-142455210 AACCCAGGACCACCCAGCAGAGG - Intergenic
1033554191 7:142474110-142474132 AACCCAGGACCACCCAGCAGAGG - Intergenic
1033556452 7:142492191-142492213 AACCCAGGACCACCCAGCATAGG - Intergenic
1033558824 7:142511640-142511662 AACCCAGGACCACCCAGCATAGG - Intergenic
1034479586 7:151309103-151309125 TTCCCTGGATGACCCAGATGAGG - Intergenic
1034731155 7:153388671-153388693 TGCCCAGGACCTCCCAGATAAGG - Intergenic
1035305014 7:157926580-157926602 TACTCAGGAACACACAGCTGTGG - Intronic
1035365096 7:158344187-158344209 TACCCAGGACAGCACAGACGGGG + Intronic
1035708414 8:1695129-1695151 TGACCAGGACCACCCAGCTGCGG + Intronic
1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG + Intergenic
1039375096 8:37024913-37024935 TGCACAGGAGCACCCAGCTGAGG - Intergenic
1045049092 8:98306606-98306628 CCCCCAGGAGCACCCAAATGAGG - Intergenic
1049453542 8:142675450-142675472 TCCCCAAGCCCACCCAGCTGGGG - Intronic
1049554512 8:143275321-143275343 ACCCCAGGGCCGCCCAGATGTGG - Intronic
1050599185 9:7233708-7233730 TTCCCATGACCTCCCCGATGCGG + Intergenic
1051016980 9:12490014-12490036 TTCCCAGGCCAACCAAGATGGGG - Intergenic
1051497390 9:17739065-17739087 TACCCAGGTCCACCCTGTTGTGG + Intronic
1060488647 9:124065626-124065648 TGCCCAGGGTCACCCAGAGGGGG - Intergenic
1060815932 9:126635150-126635172 TACCCAGGGCCACACGGCTGGGG + Intronic
1060966144 9:127713279-127713301 TCCCCAGGGCCACACAGCTGTGG - Intronic
1061511883 9:131066787-131066809 TGCTCAGGACCACACAGCTGTGG + Intronic
1062472749 9:136713418-136713440 GACCCAGGACCACCCTGCGGGGG - Intronic
1203492832 Un_GL000224v1:122959-122981 GACCCAGAACATCCCAGATGTGG + Intergenic
1203505453 Un_KI270741v1:64830-64852 GACCCAGAACATCCCAGATGTGG + Intergenic
1185650372 X:1643178-1643200 TACTGAGGACCACGCTGATGGGG + Intergenic
1186761565 X:12728925-12728947 TTCCCAAGTCCACTCAGATGTGG + Intergenic
1188424520 X:30031203-30031225 TCCCCAAGATCACCAAGATGAGG + Intergenic
1190059446 X:47201471-47201493 TAACCAGGACAACCCCGGTGTGG + Exonic
1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG + Intergenic
1199947340 X:152679904-152679926 AACCCAGGACCACCCGGGGGCGG + Intergenic
1199962340 X:152788550-152788572 AACCCAGGACCACCCGGGGGCGG - Intergenic
1201368354 Y:13234142-13234164 TGCCAAGGGCCAGCCAGATGTGG + Intergenic