ID: 1029410096

View in Genome Browser
Species Human (GRCh38)
Location 7:100403967-100403989
Sequence TGGGAGAAACAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 671}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029410096_1029410106 19 Left 1029410096 7:100403967-100403989 CCCTCCCCATTCTGTTTCTCCCA 0: 1
1: 0
2: 3
3: 66
4: 671
Right 1029410106 7:100404009-100404031 GCCCATCCATCCTAGATACTGGG 0: 1
1: 0
2: 1
3: 8
4: 66
1029410096_1029410105 18 Left 1029410096 7:100403967-100403989 CCCTCCCCATTCTGTTTCTCCCA 0: 1
1: 0
2: 3
3: 66
4: 671
Right 1029410105 7:100404008-100404030 TGCCCATCCATCCTAGATACTGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029410096 Original CRISPR TGGGAGAAACAGAATGGGGA GGG (reversed) Intronic
901823858 1:11847849-11847871 TGCAAGTGACAGAATGGGGAGGG - Intronic
901842835 1:11964618-11964640 TGGGAGAGACAGAAAGCGGGTGG - Intronic
902980251 1:20117615-20117637 TGGGAGAAACAGATGGCAGAAGG + Intronic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903695288 1:25201727-25201749 TGGGAGCAAAAGAGTGGGGTTGG - Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
905122947 1:35695716-35695738 TGGGATCAACACAGTGGGGAGGG + Intergenic
905388256 1:37619296-37619318 TGGGAAAATCAGAATAGAGATGG + Intronic
905447031 1:38034243-38034265 TGGGGGAGACAGAATAGGAATGG + Intergenic
905596502 1:39212211-39212233 TGGGAAAAAAAGAAGGGGAATGG + Intronic
905683639 1:39892921-39892943 GGGGAAAAAGAGGATGGGGATGG - Intergenic
906149357 1:43578511-43578533 TGGCAGAAACTGAATGGAGCTGG + Intronic
906248751 1:44295204-44295226 TGGGAGAGGAAGAATGGGCAGGG + Intronic
906474425 1:46158701-46158723 TCAGAGAAACAGAACTGGGATGG + Intronic
906532002 1:46529131-46529153 TGGAAGTAACAGAGTGGCGAGGG - Intergenic
906636843 1:47415917-47415939 GGGGAGGAGCAAAATGGGGAGGG + Intergenic
907009203 1:50947195-50947217 AGGGAAAAAGAGGATGGGGAGGG + Intronic
907409453 1:54274154-54274176 GGCGAGACCCAGAATGGGGAGGG + Intronic
907944264 1:59119615-59119637 TGGGAGACAGAGATGGGGGATGG - Intergenic
907961084 1:59282322-59282344 GGGGAGATAAAGAATGGGAAAGG - Intergenic
908226547 1:62061470-62061492 TGGGAAAAACAGGCTGGGCACGG - Intronic
909186543 1:72493695-72493717 TGGGGGAAACAAAACGGGGTGGG + Intergenic
910324428 1:85989205-85989227 AGGGAGGAACATAATGGAGAAGG - Intronic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
911909622 1:103616418-103616440 AGGGAGAAACAGAACAGGGCAGG + Intergenic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
911945747 1:104106615-104106637 TGGGAGAAAAAGAAGCAGGATGG - Intergenic
912210666 1:107553358-107553380 TCGGAGAGAATGAATGGGGAGGG + Intergenic
912375370 1:109205283-109205305 TGGTAGATATAGAAAGGGGATGG + Intronic
912466663 1:109879329-109879351 TGGGGGAATCATAAAGGGGAGGG + Intergenic
912710490 1:111946250-111946272 TGGGGGAAAGAGTTTGGGGAAGG + Intronic
914340471 1:146755769-146755791 TTAGAGAAACATTATGGGGATGG + Intergenic
914995513 1:152540057-152540079 TGGCAGGAACAGAATGGAGAAGG - Intronic
915003016 1:152610845-152610867 TGGCAGGAACAGAATGGAGAAGG + Intergenic
915007764 1:152655888-152655910 AGGGAGGAAGAGATTGGGGAAGG - Intergenic
915062172 1:153195226-153195248 TGGAAGAAAGAGATTGGAGAGGG - Intergenic
915211539 1:154313243-154313265 GGAGAGATACAGAAAGGGGACGG - Intergenic
915293433 1:154902068-154902090 TGGGGGAGTCAGTATGGGGATGG + Intergenic
915505708 1:156355002-156355024 TGGGAGAAATGGAATTTGGAAGG + Intronic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916723959 1:167506357-167506379 TGAGAGAAAAAGAAAGGGAAGGG - Intronic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
920068031 1:203282909-203282931 TGGGAGAAACAGAGGGTGGCAGG - Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920983060 1:210856404-210856426 TGGGAGAAACAGTTTTGGGGTGG - Intronic
922022160 1:221716307-221716329 TTTGTGAGACAGAATGGGGAGGG - Intronic
923116100 1:230939235-230939257 AGGGAGATACAGAAAGGGAAAGG - Intronic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923697007 1:236263105-236263127 TGGGAACAACAGTTTGGGGAAGG - Intronic
923887260 1:238172835-238172857 TGGGAGCAAGAGAATTTGGAAGG - Intergenic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062068 1:240185172-240185194 AGGGAGAAAGAGAAGGGGAAAGG - Intronic
924630588 1:245736470-245736492 TGGCAGAAACAATATGGGGATGG + Intergenic
1063143741 10:3277484-3277506 TGAGAGTAACAGAACGCGGAAGG - Intergenic
1063821521 10:9841973-9841995 TGGGAGAAGCAGAATTGCGGTGG - Intergenic
1065371515 10:24991631-24991653 TGGGAGAGCCAGAAGGGAGATGG - Intronic
1065621292 10:27584883-27584905 TGAGAGAAAATGAATGGGAAGGG - Intergenic
1066334558 10:34462987-34463009 GGGAGGAAAGAGAATGGGGAGGG + Intronic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1066507470 10:36060336-36060358 AGGAAGAGACAGAGTGGGGAGGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067521211 10:47007773-47007795 TTGAAGAAAGAAAATGGGGAGGG + Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067921925 10:50467927-50467949 TGATAGAAACAGAAGGGGAAGGG + Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068538262 10:58264953-58264975 TGGGAGAATGAGTAGGGGGAAGG + Intronic
1069149792 10:64945373-64945395 TGGGACTATCAGAATGGGGATGG + Intergenic
1069352923 10:67551378-67551400 TGGGGGAGACAGAAAGGAGATGG - Intronic
1069615936 10:69806220-69806242 TGGGAGAAGGACACTGGGGAGGG + Intronic
1069717559 10:70530715-70530737 TGAGTGAGACAGAATGGGGTGGG + Intronic
1069856016 10:71441383-71441405 TGAGTGGAACAGAATGGGGGAGG - Intronic
1070074512 10:73122153-73122175 TCTAAGAAACAGAAAGGGGAAGG - Exonic
1070239586 10:74665364-74665386 TGGAAGAAACAGAAAAGTGATGG - Intronic
1070505534 10:77109744-77109766 GGGGAGGAACATAAAGGGGAAGG + Intronic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070988356 10:80708228-80708250 TGGGATAAGCGGAATGGGGAAGG + Intergenic
1071156044 10:82690919-82690941 TGGAAGAAAGAGAATGAGCAGGG - Intronic
1071159996 10:82734542-82734564 TGGGAGGGAGGGAATGGGGAGGG - Intronic
1071335669 10:84598557-84598579 TGGGAGAGAGAGAAAGGAGAAGG - Intergenic
1071338570 10:84621950-84621972 TGGGAGCAAGAGCAAGGGGAAGG - Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072735937 10:97879834-97879856 TGGGAAAAAGAGAAAGGGGGTGG + Intronic
1072787577 10:98294672-98294694 TGCTAGAAACAGAAAGGGTAGGG - Intergenic
1073096726 10:100984466-100984488 TGGGAGAAAGAGAAAGGGTTTGG - Exonic
1074084070 10:110194223-110194245 TTGGAGAAAGAGGATGGGGTAGG + Intergenic
1074616982 10:115079359-115079381 TGGGAGAAGCAGGTTTGGGAGGG - Intergenic
1075080099 10:119377902-119377924 TGGGAAAAACTGATTGGGAAAGG + Intronic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075918749 10:126191963-126191985 AGGAAGAGAGAGAATGGGGAGGG + Intronic
1075970439 10:126647571-126647593 TGGAAGAGACAGAATGGGGTGGG + Intronic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1077166472 11:1142023-1142045 GGAGAGAAAGAGGATGGGGATGG + Intergenic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1077575943 11:3383582-3383604 TGACAGAAACTGAATGAGGAGGG + Intergenic
1078117020 11:8463615-8463637 GGTGAGAAACAGAATTGAGATGG - Intronic
1078369518 11:10733422-10733444 TGGGAGTGACAGAGGGGGGATGG - Intergenic
1078379598 11:10828500-10828522 TGAGAGAAAAAGACTTGGGAGGG - Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1079460784 11:20676073-20676095 TGGCAGAAACTGAATGGGCCAGG - Intronic
1080381785 11:31779389-31779411 TGGGAGAAACGGAATTAGGAAGG + Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081397291 11:42601737-42601759 TAGGAGAAAAGGAAAGGGGAAGG - Intergenic
1082189365 11:49224143-49224165 TGTGAAGAAGAGAATGGGGAAGG + Intergenic
1082244444 11:49905219-49905241 GGGGGGAAATAGAAGGGGGAAGG + Intergenic
1083443900 11:62694505-62694527 TGGCAGGATCAGAATGGGTAGGG - Intronic
1084470273 11:69355478-69355500 TGGGAGGCACAGAATAAGGAGGG - Intronic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084557860 11:69885629-69885651 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084557879 11:69885685-69885707 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084899373 11:72298245-72298267 TGGGAGAACTAGACTGGGTAGGG + Intronic
1085088673 11:73691080-73691102 AGGGACACACAGAAAGGGGATGG + Intronic
1085843217 11:80037557-80037579 AGGAAGAAAGAGAATGGGGTAGG - Intergenic
1086677159 11:89622353-89622375 TGTGAAGAAGAGAATGGGGAAGG - Intergenic
1087015096 11:93546932-93546954 TGGAAGGAACAGCATGTGGAAGG - Intergenic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1088217592 11:107529922-107529944 AGGGAGTAACAGAAAGGGGTAGG + Intronic
1088381876 11:109201841-109201863 TGGGAGGAACAGAATGAGTGGGG - Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088707454 11:112476733-112476755 TGTGTGAATCAGAATCGGGAAGG - Intergenic
1089051046 11:115546261-115546283 TGGGAGAGAAAGAAAGAGGATGG - Intergenic
1089669656 11:120044943-120044965 TGGGAGCAAGAGACTGGGGTCGG + Intergenic
1090532577 11:127606380-127606402 TGGGAGAAATAGTATTCGGATGG - Intergenic
1090869853 11:130734491-130734513 TTGAAGAGACAGAGTGGGGAGGG + Intergenic
1091562149 12:1623004-1623026 GGGGAGAAACAGGATGGGTTTGG + Intronic
1091743308 12:2975267-2975289 TAGGAGAAACTGACTGGGGGCGG - Intronic
1091907490 12:4200694-4200716 TGTGAGAGGTAGAATGGGGATGG - Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092242807 12:6845858-6845880 TGGGGGGTACAGAATGGGGAGGG - Intronic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1092859837 12:12710948-12710970 TGGGAGATAGGGAATAGGGAAGG - Intergenic
1093504561 12:19850178-19850200 TGGGAGAAAAAGAATTTGGTAGG + Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1093980461 12:25469854-25469876 TGTGAGAGAAAGGATGGGGATGG + Intronic
1094686372 12:32720143-32720165 TGGGAGAATGACAGTGGGGATGG - Intronic
1095168081 12:38998380-38998402 GGGGAGAAAGGGAAGGGGGAGGG - Intergenic
1096180554 12:49548427-49548449 TGGATGAGACTGAATGGGGAGGG + Intronic
1097006977 12:55926933-55926955 TAGGAGAGAATGAATGGGGAAGG + Intronic
1097051944 12:56229016-56229038 TCTGAGAACCAGAATGGGAATGG + Exonic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098291357 12:68959618-68959640 TGGGTGAAACATCATGGGCAAGG + Intronic
1099689130 12:85927887-85927909 TGGAAGCAAGAGAAAGGGGAAGG - Intergenic
1099892080 12:88602193-88602215 GGGAAGAAACAGAATGTTGATGG - Intergenic
1100592655 12:96043944-96043966 TGGGAGAAGCAGACTGGAGTGGG + Intergenic
1100665723 12:96750395-96750417 AGGGAGGAACAGAAGGGAGATGG - Intronic
1102575615 12:113854453-113854475 TGGGGGAAGGAGAATGGGGGTGG - Intronic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1104038416 12:125114327-125114349 TGGGAGAAGCAGACTTTGGAGGG - Intronic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104931263 12:132340649-132340671 TGGGAGAAACACATTGGTGGGGG - Intergenic
1105003763 12:132708372-132708394 GGGGAGAAACGAAATGTGGAAGG + Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107364823 13:39658787-39658809 TTGGAGAAACTTAAAGGGGAAGG - Intronic
1107410112 13:40150672-40150694 TGGGGGAAACAGAGGAGGGAGGG - Intergenic
1107733838 13:43375241-43375263 AGGGAGAAAAAGAACGGGGCGGG + Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108018264 13:46098274-46098296 TGGGGAAAACAGAACGGGTAGGG + Intronic
1108415343 13:50192674-50192696 TGGGAAGAAGGGAATGGGGAAGG + Intronic
1109245815 13:59953537-59953559 TAGGAGATAAAGAATGGGTAAGG + Intronic
1109749961 13:66677606-66677628 AGAGAGAAAGAGCATGGGGAAGG - Intronic
1111478043 13:88780213-88780235 TGGGAGAAAGAACATGGTGAGGG - Intergenic
1111679185 13:91423459-91423481 TGGGAGATACAGACTTTGGAAGG + Intronic
1112838435 13:103545997-103546019 TAGCAGAAACACCATGGGGAGGG - Intergenic
1113379342 13:109787450-109787472 TAGGAGAAAGAGATCGGGGACGG + Intergenic
1114158900 14:20140413-20140435 TAGCAGGAAGAGAATGGGGAAGG + Intergenic
1114583493 14:23787392-23787414 TTGCAGAAACAGAATGGAGCTGG - Intergenic
1114850958 14:26382056-26382078 TGGGAGGAACAGAGGGGAGAGGG - Intergenic
1116485655 14:45444948-45444970 TGAGAGAAAGAGAATGGGCAAGG - Intergenic
1116762903 14:49037055-49037077 AGAGAGAAAAAGAATGGGAAAGG + Intergenic
1116809085 14:49522238-49522260 AGGAAGAGACAGAATGGGGAAGG - Intergenic
1117168733 14:53068078-53068100 TGGCAGAATTAGAATGTGGATGG - Intronic
1117334132 14:54742327-54742349 GAGGAGAAATAGAATGGGGGGGG + Intronic
1117373993 14:55104230-55104252 TGGGAGCAACAGAAAAGAGAAGG + Intergenic
1117722801 14:58643818-58643840 TGGGAGAGGAAGGATGGGGAAGG + Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118878204 14:69802788-69802810 AGGGAGAAAGAGAATGCAGAGGG + Intergenic
1119479731 14:74951866-74951888 TGGGAGAAACAAAAGGGGCTGGG + Intronic
1119630212 14:76224229-76224251 TGGGAAAAGGGGAATGGGGAAGG + Intronic
1119668889 14:76503985-76504007 TGGGCGAAATGGAATGGGGGAGG + Intergenic
1119891873 14:78189004-78189026 TGGGAGGAGCAGATTGGGGCAGG - Intergenic
1120147651 14:80996829-80996851 TGGGAGAAACAGATTTGGAGTGG - Intronic
1120763155 14:88304074-88304096 TGGGAGAGTGAGAAGGGGGATGG + Intronic
1121011421 14:90522383-90522405 TGGGAGAAACAGAGGCGGGGAGG + Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121711186 14:96039925-96039947 TCGGGAAAACAGAGTGGGGAAGG - Intronic
1121772679 14:96562793-96562815 TGAGACAAAGAGGATGGGGAAGG - Intronic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122084699 14:99291465-99291487 TGGGAGAAAGAGAAAGGTCAGGG - Intergenic
1123082190 14:105700633-105700655 TGGGAGAAAAAGAGAGGAGATGG - Intergenic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1124915447 15:33966622-33966644 TGGATGAAAGAGAATGGGGGTGG - Intronic
1126525429 15:49648996-49649018 TAGGAGTAACAGAATGGGAAAGG + Exonic
1126535408 15:49756743-49756765 TGGAGGAAACAGAATGGGATTGG + Intergenic
1126861261 15:52885207-52885229 AGGGAGAAACAGATTTGGAATGG - Intergenic
1127333919 15:57965251-57965273 TGCGAGCAACAGAAAGGGGCTGG + Intronic
1127683073 15:61316313-61316335 TGGGAGAACAAGAATGTTGAAGG - Intergenic
1127735459 15:61835034-61835056 AGGAGGAAACAGAATGGGGTAGG + Intergenic
1127743351 15:61937053-61937075 AGAGAGAGACAGAATGGAGATGG - Intronic
1128171373 15:65516973-65516995 TGGGTGGAACAGAATGGGAGAGG + Exonic
1128352893 15:66903235-66903257 TGGTAGAAACAGAATGAGCTGGG + Intergenic
1128355391 15:66923000-66923022 TGGGAGAAACAGGAAAGGGGTGG - Intergenic
1128826368 15:70721223-70721245 TTCTAGAAACAGAATGGGAATGG - Intronic
1129343194 15:74899536-74899558 TGGGAACAGCAGAAAGGGGAGGG + Exonic
1130161123 15:81401340-81401362 TGGGAGAAAGTGAAGGGGGCTGG + Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1131130695 15:89898379-89898401 TGTGAGAAACAGTTTGGGAAGGG - Exonic
1131342493 15:91615600-91615622 TGGGAGAAGCTGATTTGGGAAGG + Intergenic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1131735935 15:95332383-95332405 TGGGAAAAAGAAAATGGGGCTGG - Intergenic
1132140954 15:99394511-99394533 TGGGTGATACTGAATTGGGAAGG - Intergenic
1133080479 16:3315108-3315130 TGGGAAAAACATGATGGAGAAGG - Intronic
1133221933 16:4322624-4322646 TGGGAGAAACAGTGTAGGGGGGG - Intronic
1133358964 16:5158465-5158487 CGGGAGCAAGAGAATGAGGAGGG - Intergenic
1133489993 16:6258496-6258518 TGAGATAAACAGAATTGTGATGG - Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133848940 16:9483656-9483678 GGGGAGAAGCAGCATGGGAAGGG + Intergenic
1135616397 16:23914472-23914494 TGGGAGAGGCAGAATGGTGTTGG + Intronic
1135770301 16:25213156-25213178 TGGGAAAAAGAGAATGTGGAGGG - Intergenic
1135833509 16:25800419-25800441 TGGGAGAGAAAGTAGGGGGAAGG - Intronic
1136360409 16:29775818-29775840 TTGGAGAAAAAGAGAGGGGAAGG + Intergenic
1137033249 16:35544182-35544204 TGGGAGATTCAGGATGGAGATGG - Intergenic
1137573573 16:49583037-49583059 AGGCAGGAACAGAAAGGGGAAGG - Intronic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138103649 16:54274834-54274856 TGGGAAATGCAGAATGGGGCTGG - Intergenic
1138457665 16:57130740-57130762 TGGCAGAGACAAGATGGGGAGGG + Intronic
1138527796 16:57619101-57619123 TGGGAGAAACAGTGGGGTGAGGG + Intronic
1138535672 16:57659050-57659072 GGGAAGACACAGAATGTGGATGG + Intronic
1138918163 16:61493696-61493718 TGAGAGAAGCAGATTGGAGAGGG + Intergenic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139993816 16:70961637-70961659 TTAGAGAAACATTATGGGGATGG - Intronic
1140128489 16:72137412-72137434 TGGGGGAAACAGAAGAGCGAAGG + Intronic
1140145172 16:72300067-72300089 AGGTAGAAAGAGAAGGGGGATGG - Intergenic
1140351563 16:74266718-74266740 TAGAAGACACAGAATGGAGAAGG - Intergenic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141337992 16:83175490-83175512 CAGGAGAAACTGTATGGGGATGG + Intronic
1142943199 17:3400684-3400706 TGGGACAAACAGAAAGAAGAAGG + Intergenic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143454878 17:7060562-7060584 TGGGAAAAAAAGAATGGCAAGGG - Intergenic
1143755531 17:9064533-9064555 AGGGAGGAACTGATTGGGGATGG - Intronic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1143908949 17:10231724-10231746 TGGGAGAGAGAAGATGGGGATGG - Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144006606 17:11106082-11106104 TGAGTGAAACAGGATGAGGAGGG - Intergenic
1144197802 17:12912121-12912143 TGGAAGAAACAGATTGTGTAGGG + Intronic
1144460292 17:15453087-15453109 TGAGAAACACAGAATGAGGAAGG + Intronic
1144517156 17:15926589-15926611 TGTGAGCAGCAGAATGGGCAAGG + Intergenic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1146065236 17:29629823-29629845 TGGGGACAACAGCATGGGGAAGG + Exonic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1147241959 17:39096329-39096351 TGGGAAAAACAGAAGTGAGAAGG + Intronic
1147632480 17:41941010-41941032 TGGCAAAAACAGAGAGGGGAAGG - Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148148845 17:45384255-45384277 TGGGAAAGACAGATGGGGGAAGG + Intergenic
1148188333 17:45660779-45660801 TGGGGGAAAGAGAAAGGGGCGGG - Intergenic
1148208124 17:45792264-45792286 TGGCAGAAAGAGGAAGGGGAAGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148741784 17:49897267-49897289 AGAGAGAGAAAGAATGGGGAAGG + Intergenic
1148808308 17:50275151-50275173 TGGGAGGAACAGAAGGGCGGAGG - Intronic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1150316455 17:64173262-64173284 TGGGAGAAAAAAAAAGGAGAGGG - Intronic
1150793850 17:68222199-68222221 GGGGAGAAACAGACTTGGGTGGG + Intergenic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151147277 17:72053093-72053115 TGGCTGAAACAGAAGGGTGATGG - Intergenic
1152872716 17:82766446-82766468 TGAAAGAAACAGGAAGGGGAAGG - Intronic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1155185797 18:23385615-23385637 TGGGTGGAACATAATGAGGAAGG + Intronic
1155219547 18:23671810-23671832 TGGGGAAGACAGTATGGGGAGGG + Intergenic
1155778133 18:29794218-29794240 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1156870183 18:41936975-41936997 TGGGAAGAACAGAAAGGGGAGGG + Intergenic
1158490964 18:57909457-57909479 TGTGAGAAAGAGAAAGGGGAAGG - Intergenic
1158744842 18:60188183-60188205 TGGGAGCCACAGGATGGTGAGGG + Intergenic
1159784723 18:72699247-72699269 TGTGAAAAACAGAATGGTAAAGG - Intergenic
1160286306 18:77546866-77546888 TAGAAGAAACAGAAGAGGGAGGG - Intergenic
1160343855 18:78113194-78113216 TGGGAGAAAAAGAATGATGTAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161633086 19:5369197-5369219 TAGGAGCCACAGGATGGGGAGGG - Intergenic
1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG + Intronic
1162403902 19:10462076-10462098 TGGGAGAAAGAGGCTGAGGAAGG - Intronic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1164399700 19:27894126-27894148 TAGAAGGAACAGAATGTGGAAGG - Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164676431 19:30104666-30104688 TGGGAGAAACAGAAGGTGAGAGG - Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1165506940 19:36239036-36239058 TGGGGGTAGAAGAATGGGGATGG - Intronic
1166075849 19:40413400-40413422 GGGGGGAAAAGGAATGGGGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166368628 19:42289816-42289838 TGGAGGGAACAGTATGGGGAGGG - Intronic
1166381959 19:42359294-42359316 TGGGAGTCCCAGGATGGGGATGG - Intronic
1166532552 19:43551810-43551832 TGGGAGAAACAAAAAGAGGTTGG + Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167706430 19:51083931-51083953 TGGGAGAAAGAGGATGGGACAGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167756977 19:51418777-51418799 TGGGGGGAACAGACTAGGGAAGG + Intergenic
1168426820 19:56245706-56245728 TTGAGGAAACTGAATGGGGAAGG - Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1168609816 19:57790173-57790195 TGGGAGAAGGAGGATGGGCAAGG + Intronic
1168651903 19:58097342-58097364 TGAGAGAAAGGAAATGGGGAAGG + Intronic
925239585 2:2312167-2312189 TAAGCGGAACAGAATGGGGAGGG - Intronic
925322875 2:2990399-2990421 AGGCAGTAACAGAATGGGAAGGG + Intergenic
926040334 2:9667608-9667630 AGGCAGAAAAGGAATGGGGACGG + Intergenic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
928213538 2:29341946-29341968 TGGGAGAAACCTAATGAAGAAGG + Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
929385709 2:41403722-41403744 AGGGAGAAAAGGAAAGGGGAAGG + Intergenic
929419728 2:41778443-41778465 GGGAAGAAATAGAATAGGGAGGG - Intergenic
929628516 2:43434683-43434705 TGGGGGAACCAGAAGGGAGATGG - Intronic
929978601 2:46658036-46658058 TGGGAGGACCAGGCTGGGGAAGG + Intergenic
930454019 2:51581901-51581923 TGGGCGAATCAGAACGGAGATGG - Intergenic
930559318 2:52940637-52940659 TGGTAGAAACAGAATGATAATGG - Intergenic
930731908 2:54735973-54735995 AGGTGGAAAAAGAATGGGGAAGG + Intronic
931348836 2:61470840-61470862 GGGGAGCAAGAGAATGGGGGAGG + Intergenic
932196574 2:69788945-69788967 TGGGACAAACTGGATGGGGAGGG + Intronic
932426129 2:71636552-71636574 TGGGAGGAGCAGACTGGGCAGGG + Intronic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933429546 2:82158069-82158091 TGGGAGACAAAGAATGGCTATGG - Intergenic
933836695 2:86251602-86251624 TGGGAGAAACAGAAGAGGGCAGG - Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935208103 2:100914142-100914164 TGGGAGAAACCCAAGGGGTATGG + Intronic
935855343 2:107267338-107267360 TAGGAGAGATAGAAGGGGGAAGG + Intergenic
936334552 2:111577478-111577500 TGGGAAAAAAAAAATGGAGAAGG - Intergenic
938451140 2:131422015-131422037 TTGGAACAACAAAATGGGGAGGG - Intergenic
939008639 2:136819436-136819458 TGAGGGAAAAAGAAGGGGGAGGG - Intronic
939964024 2:148592947-148592969 TGGGGCAAGCAGGATGGGGAAGG + Intergenic
940647916 2:156411013-156411035 TGGGAGAAAAATAATAGGGTTGG + Intergenic
940900694 2:159123930-159123952 TGGGAAAAACAGCAGCGGGAGGG - Intronic
941380129 2:164782520-164782542 AGGAAGAAAGGGAATGGGGAGGG + Intronic
942311192 2:174658466-174658488 GGTGAGAAACAGGATGGAGAGGG + Intronic
942374937 2:175327302-175327324 TGGGAGAAAGAGAATTAGGGAGG + Intergenic
942891758 2:180998444-180998466 TGGGATAAGGAGAGTGGGGAAGG + Intronic
943121036 2:183735974-183735996 TGGAAAGTACAGAATGGGGAAGG - Intergenic
944490519 2:200253865-200253887 TGAGAGAAACAGGACAGGGATGG - Intergenic
944728355 2:202495285-202495307 TGGGGGAACCAGAAGGGAGATGG + Intronic
944958642 2:204842515-204842537 TGCCAGAAAAAGAATGGAGAGGG + Intronic
945975210 2:216265069-216265091 TGGGAAAAAGGGAAGGGGGATGG + Intronic
946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG + Intergenic
946733362 2:222730341-222730363 GGAGAGAAAATGAATGGGGAGGG + Intergenic
946766931 2:223049596-223049618 TGGGAGTGACAGACAGGGGAAGG + Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947021546 2:225683012-225683034 TAGGAAGAACAGAATGGGGGGGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947593419 2:231397096-231397118 TGGGTGAGACAGACTGGAGAAGG + Intronic
1169495671 20:6112759-6112781 TTGAAGAAACAGAAGGGGAAAGG + Intronic
1170203282 20:13768320-13768342 TGGGAGAAAGAAAAAGGAGAAGG + Intronic
1170700793 20:18701524-18701546 TAGGAGCAACAGAATGCGGGTGG + Intronic
1170884017 20:20322538-20322560 TGGGAGAACAAGAATTGAGAAGG - Intronic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172484649 20:35291053-35291075 CAGGAGAAAGAGAATTGGGAGGG - Intronic
1172621694 20:36321694-36321716 TGGGAGAACGAGCATGGGGAGGG + Intronic
1172808767 20:37632231-37632253 GGAGAGAAATAGAGTGGGGATGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173304403 20:41834711-41834733 AGGGAGGATCAGAATGGTGAGGG + Intergenic
1173331371 20:42078722-42078744 TGGGAGAAGCAGTCTGGGGGAGG - Exonic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173602862 20:44308492-44308514 TGGGAGAAACAGCATGAGTCTGG - Intronic
1174001758 20:47379891-47379913 TGGGAGGAACAGGCTGGGGGAGG + Intergenic
1174441328 20:50557471-50557493 GGGGAGGAAAAGAAAGGGGATGG - Intronic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175872033 20:62213367-62213389 TGGGGGAAGGAGAGTGGGGATGG + Intergenic
1177888204 21:26771747-26771769 TGGGAGAAACAGATTTGAAAGGG + Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178584721 21:33862480-33862502 TGGGAGAAGGAGAAGAGGGAAGG + Intronic
1178833278 21:36074150-36074172 TGGAAGAAACAGAATGGCCTGGG - Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1179247057 21:39643088-39643110 TGGGATAGACACAGTGGGGAGGG + Intronic
1179286106 21:39978554-39978576 TGGGAGAGACAGCATGAGCAGGG + Intergenic
1179947420 21:44687629-44687651 TGGGTGAAATTGACTGGGGAAGG + Intronic
1180098614 21:45573961-45573983 TGTGACAAACAGAATGGGCGAGG - Intergenic
1181000507 22:19985901-19985923 TGGGAGGGCCATAATGGGGATGG - Intronic
1181632718 22:24159663-24159685 TGGGAATGACAGAATGGGGCAGG + Intronic
1181959107 22:26610333-26610355 TGGGAAAAAAAGAATGAAGAGGG - Intronic
1182019243 22:27067042-27067064 TGGCAAAGACAGAATCGGGATGG - Intergenic
1182611113 22:31548267-31548289 TGGGAGAAAATATATGGGGAAGG + Intronic
1183210390 22:36447749-36447771 TGAGAGACACTGAGTGGGGAAGG + Intergenic
1183315612 22:37135454-37135476 TGGGAGAAACAGCAAGGAGAGGG + Intronic
1183823462 22:40366076-40366098 TGAGAGACACAGACCGGGGAGGG + Intronic
1183867462 22:40715155-40715177 TCATAGAAACAGAAAGGGGAAGG + Intergenic
1184110698 22:42392454-42392476 AGAGAGAAACAGAAAGGAGAGGG + Intronic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
1185225620 22:49650373-49650395 TTGGAAAAAATGAATGGGGAAGG + Intronic
1203290488 22_KI270735v1_random:32498-32520 AGGGATGAACAAAATGGGGAAGG + Intergenic
950031526 3:9856992-9857014 TGGGACAAACAGAAAGGAGGTGG - Intergenic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950415356 3:12866169-12866191 TGGGACAAACAGAAAGGAGGTGG - Intronic
950416988 3:12874457-12874479 TGGGACAAACAGAAAGGAGGTGG - Intergenic
950797254 3:15520313-15520335 TGTGAGAAACAGAAGGAGGTGGG - Intronic
951488434 3:23241080-23241102 TGGGTGAAGCAGATTTGGGAGGG - Intronic
951908748 3:27728621-27728643 TGGGAAAAACAGAATGCTAATGG - Intergenic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952924187 3:38309226-38309248 TGGGAGAAAGTGCATGTGGATGG + Intronic
953278927 3:41533108-41533130 TGGGAGCCTCAGTATGGGGAGGG - Intronic
953395091 3:42562708-42562730 TGGGAGAAGAGGAATGGAGATGG - Intronic
953411040 3:42690672-42690694 GAGGAGCAAGAGAATGGGGAAGG + Intronic
953699008 3:45181698-45181720 TGGGACTAACACAGTGGGGATGG + Intergenic
953703752 3:45215907-45215929 TGAGGGAAGCAGAATGGGGCAGG - Intergenic
953740383 3:45533601-45533623 TGGGAGAAACAAAATGAAGGAGG - Intronic
953916381 3:46923444-46923466 TGGGAGAAAGAGGAGGAGGAAGG + Intronic
954966426 3:54615490-54615512 TGTGAGAAAAATAATGGAGAGGG + Intronic
956060109 3:65340555-65340577 TGGGTGTAACAAAATAGGGAAGG + Intergenic
956138185 3:66119474-66119496 TGGGAGAAACAGGGAGGGTACGG - Intergenic
956544813 3:70389091-70389113 TGGAAGAAACAGAAAGGGAATGG - Intergenic
957551933 3:81717566-81717588 CGGGAAAAACAAAATGGAGAGGG + Intronic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
958194403 3:90224367-90224389 TGGGAGAAATAAAGTGTGGAAGG + Intergenic
958877940 3:99637439-99637461 TGGGAGATACAGTACCGGGAGGG - Intergenic
959090763 3:101900258-101900280 TGGGAGAAAACGAAAGGAGAGGG + Intergenic
959133296 3:102385254-102385276 TGGAAGAGGCAGAATGGGGGTGG - Intronic
960062824 3:113340902-113340924 TGGGAGAACCAGAAGGGAGATGG + Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960322571 3:116254428-116254450 AGGGAGAAAGAGAAAGGGAAAGG + Intronic
960600540 3:119453661-119453683 TGGAAGAAGCATATTGGGGATGG + Intronic
960811519 3:121631683-121631705 GGGCAGAGACAGCATGGGGAAGG - Exonic
960970246 3:123134483-123134505 TGGGTAACACAGAACGGGGAGGG - Intronic
961110361 3:124278343-124278365 TGGGAGAAAAAGCATGGAGGTGG + Intronic
961289140 3:125831408-125831430 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
961339503 3:126208533-126208555 TGGAAGACACAGAATGGAGAGGG + Intergenic
961783676 3:129336623-129336645 TGGGACAAACAGAAAGGAGGTGG - Intergenic
961938608 3:130612749-130612771 TGGGGGCATCAGAAAGGGGAGGG + Intronic
962312718 3:134337515-134337537 TGGGAGAGACAGACAGGGGTGGG - Intergenic
962431493 3:135324524-135324546 GGGGAGAAACAGGGTGGAGAAGG + Intergenic
962913017 3:139872343-139872365 TGACAGAAACAGAACAGGGATGG + Intergenic
963006146 3:140727705-140727727 TGGAAGAAAGAGACTGGGAAAGG - Intergenic
963213144 3:142716449-142716471 TGGGAGAAAGAGAGGAGGGAAGG + Intergenic
963274846 3:143319726-143319748 GGGGAGAAACTAAGTGGGGAAGG + Intronic
963280279 3:143377830-143377852 TGGGAGAAACAGACAGGGGCAGG - Intronic
963852739 3:150224395-150224417 TGGGAGAACATGAATGGGAATGG + Intergenic
964155692 3:153582451-153582473 TGGGTGAGACAGAAGGGGAATGG - Intergenic
964626157 3:158762049-158762071 TGGCAGGAGCAGGATGGGGAAGG + Intronic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964756309 3:160093193-160093215 TGGGCGAGACAGTGTGGGGAAGG - Intergenic
965610845 3:170542474-170542496 TGCAAGAGGCAGAATGGGGAAGG - Intronic
965871288 3:173268161-173268183 TGGGAGAAACAGTAGGGAGTGGG + Intergenic
965972673 3:174581524-174581546 GGGGATAAAAAGAATTGGGAAGG + Intronic
966055830 3:175688408-175688430 TGGGAGAGACAGAATTGGGCTGG + Intronic
966268037 3:178070415-178070437 TGGGGGAAGCAGAATTGGCAAGG + Intergenic
967008955 3:185413523-185413545 TGTTAAAAACAGAATGGGGCTGG + Intronic
967632044 3:191755746-191755768 TGGGAGCAAGAGAGAGGGGAGGG + Intergenic
968183192 3:196612458-196612480 TGGGAGTGACTGAGTGGGGAGGG - Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969108854 4:4828818-4828840 GGAGAGAAAGAGAATGAGGAGGG - Intergenic
969804851 4:9599295-9599317 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
970425299 4:15940297-15940319 TGGGAGTCACAGGAAGGGGAAGG - Intergenic
970463986 4:16304796-16304818 TGGGAGTCACAGAAGGGGAAGGG + Intergenic
970483378 4:16500270-16500292 TGGGAAAAGCAGGATAGGGAAGG - Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972127718 4:35790142-35790164 GGGGAGAAAAAGAAAGGGGAAGG + Intergenic
973738111 4:53892444-53892466 TGCTGGAAACAAAATGGGGAAGG - Intronic
974137751 4:57840080-57840102 GGGTAGAAAAAGAATGGTGAAGG - Intergenic
974993970 4:69129407-69129429 TGGGGGAGCCAGAAAGGGGACGG - Intronic
975481386 4:74884426-74884448 TGGAAGAGAGAGAAGGGGGAGGG - Intergenic
975779643 4:77824782-77824804 TGGGAGAGACAGAGGAGGGAGGG - Intergenic
976475512 4:85478019-85478041 TTGGAAAAACAAGATGGGGAAGG + Intronic
976587845 4:86818974-86818996 TGGGTCTAACAGAATGAGGAAGG + Intergenic
976702766 4:87989330-87989352 TGGGAGAAAGAGGGAGGGGAGGG + Intergenic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979309935 4:119191464-119191486 TGTGTGAAAGAAAATGGGGAGGG + Intergenic
979982099 4:127269693-127269715 TGGGGCCAACAGCATGGGGAAGG + Intergenic
980907386 4:138961693-138961715 TGTAAGATTCAGAATGGGGAGGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981673187 4:147311156-147311178 GGAGAGAAACAGAAAGAGGAGGG + Intergenic
981782321 4:148443437-148443459 TGGGAGAAACAGACAGGAGGGGG + Intronic
981792708 4:148557690-148557712 TGAAAAAAACAGAATTGGGATGG + Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983019342 4:162655917-162655939 TGGGAGAAACAGAGGAGGGCTGG - Intergenic
983433286 4:167678610-167678632 TGGGAGAACCATACTTGGGAGGG - Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
983856089 4:172647174-172647196 TGGGTGAAAGGGAATGAGGATGG - Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
987707085 5:21471334-21471356 TGGGAGAAATGGAATGAGGCTGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989173209 5:38494120-38494142 TGGGAGAGGGAGACTGGGGAGGG + Intronic
989592727 5:43126855-43126877 TGGGAGAGGGACAATGGGGAGGG - Intronic
989594388 5:43142656-43142678 TCTGAGAGACAGAATGGGGGTGG - Intronic
990715376 5:58630659-58630681 TGGGAGAAAGACAATGAGAAAGG + Intronic
990942106 5:61213174-61213196 TGAGAGAAGCAGGATAGGGAAGG + Intergenic
991032326 5:62095617-62095639 AGGGAGAAACAGAGAAGGGAAGG + Intergenic
991417394 5:66406722-66406744 TGGTGGAAACAAAATGGGGAAGG + Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992779595 5:80116040-80116062 TGAGAGAACCATGATGGGGAAGG + Intronic
993511880 5:88780832-88780854 AGGGAGAAAGAGAAGGGGGTAGG - Intronic
994491175 5:100445411-100445433 TGGGAAGAACAGAACGGGCAAGG + Intergenic
994748209 5:103705536-103705558 TGTGAGGAGCAGAATGGTGATGG - Intergenic
994935770 5:106251568-106251590 AGAGAAAAACAGATTGGGGAGGG - Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
996555281 5:124772122-124772144 TGGGAGAATAAGATCGGGGATGG + Intergenic
996684936 5:126269687-126269709 TGGGAGGAACAGATGGGAGAAGG - Intergenic
996746245 5:126848498-126848520 TGGGAGAAACCGACAGGGGCAGG + Intergenic
996787771 5:127259172-127259194 TGGTAAACACAGAATGGGGGAGG + Intergenic
997251720 5:132393733-132393755 TGGGAGAAACAAGGTGAGGATGG - Exonic
997462223 5:134060639-134060661 TGGAAGACAAAGGATGGGGAAGG + Intergenic
999120555 5:149206333-149206355 TGTGTGAAGCACAATGGGGAAGG + Intronic
999195936 5:149781693-149781715 TGGGAGCAACAGAATGATGGGGG + Intronic
999448824 5:151663512-151663534 TGGGGGAAACACGAAGGGGAGGG + Exonic
999835728 5:155368833-155368855 AGAGAGTAACAGAAAGGGGAGGG - Intergenic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
1000131449 5:158304259-158304281 TGGGAGAATCAGACTGGGCTGGG + Intergenic
1000167923 5:158673260-158673282 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1001074540 5:168615656-168615678 TAGGAGAAACAGAGTAGGGGTGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1002129561 5:177071897-177071919 TGGGAGAGACAGGCCGGGGACGG - Intronic
1002812073 6:640259-640281 TGGGAGAGACAGAAGGGGTGCGG + Intronic
1002952536 6:1829129-1829151 TGAGAGAACAAGAAAGGGGAGGG + Intronic
1004417249 6:15436295-15436317 TGGGAGAGCCAGAAGGGAGATGG + Intronic
1004504647 6:16238378-16238400 TGGCAGTGACCGAATGGGGACGG - Intergenic
1005092503 6:22072363-22072385 GGGGAGAAAAAGAAGGGGTAGGG - Intergenic
1005724427 6:28635043-28635065 TGCTAGAGACAGAATGGGTAAGG + Intergenic
1006278743 6:33029131-33029153 TGAGAGAGACAGAAAGGAGAGGG - Intergenic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1008548014 6:52600410-52600432 TGGGGGAAAGAGACTGGAGAGGG + Intergenic
1008926030 6:56893149-56893171 TGGGAGGAAGAGTATGAGGAGGG - Intronic
1009021139 6:57949174-57949196 TGGGAGAAATGGAATGAGGCTGG - Intergenic
1010024919 6:71204132-71204154 AGGAAGAAAGAGAGTGGGGAAGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010486903 6:76425678-76425700 AGAGAGAAACAGAATGGGATGGG + Intergenic
1010833457 6:80557878-80557900 GGGGAGAAAAAGAGTTGGGAGGG - Intergenic
1011306043 6:85927980-85928002 TGGGAGTAGGAGAGTGGGGATGG - Intergenic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011458150 6:87574571-87574593 AGGGAGAGAGAGAATAGGGAGGG + Intronic
1011617714 6:89212273-89212295 TGGAATGAACAGGATGGGGATGG - Intronic
1011708498 6:90027250-90027272 TGGGAGAAAAAGAATGTGCTTGG + Intronic
1013521265 6:110935910-110935932 TACTAGAATCAGAATGGGGAGGG - Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014543984 6:122710934-122710956 TGGGAAAAAAAGAATGAGAAGGG + Intronic
1014743356 6:125171149-125171171 TGGTAGAAACAGAAATGGGTGGG - Intronic
1015168497 6:130225360-130225382 TGGGAAAACAAGAATGTGGAAGG + Intronic
1015431701 6:133138394-133138416 TGGGAGAGAGAGAAGGGGAAAGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016870311 6:148809568-148809590 TAGCAGAAACAGAACTGGGAAGG + Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017333667 6:153229309-153229331 TGGGAAAAACAGAAGAGTGAAGG + Intergenic
1017805174 6:157939635-157939657 TGGGAGAAAGAGAAGGATGAGGG + Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018919504 6:168161515-168161537 GGGGAGGAGCAGCATGGGGAGGG - Intergenic
1019351812 7:557558-557580 AGGGAGAAACAGGATGGACATGG + Intronic
1020915081 7:14183506-14183528 AAGGAGAAACTGTATGGGGAAGG + Intronic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021989941 7:26131413-26131435 TGAGGGAAACAGAAGGGGAATGG + Intergenic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1022533482 7:31081383-31081405 TGGGAGAAAATGAAAAGGGATGG - Intronic
1022778425 7:33552943-33552965 TGGGTAAAGCAGAATGGGCAAGG - Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1023007105 7:35883383-35883405 TGGGAGCCACAGAATTGTGAAGG + Intronic
1023727013 7:43153305-43153327 TTGGAAAAAGAGAATGGAGATGG + Intronic
1023939964 7:44763020-44763042 TGGGCCACACAGAATGGGGATGG - Intronic
1024130888 7:46352149-46352171 AGAGAGAAAGAGAAAGGGGAGGG + Intergenic
1027122459 7:75531708-75531730 GGGGAGACACAGATTGGGAAAGG - Intergenic
1027508932 7:79054656-79054678 TGGGAGGAACAGAATGGAGATGG - Intronic
1027674263 7:81140559-81140581 TGGAAGAAACAGTATGGGCTGGG - Intergenic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1027964259 7:84985406-84985428 TGGGGGAAACAGGATGGGATTGG - Intergenic
1028131258 7:87176572-87176594 TGGTAGAAATAGAATTGGTAGGG + Intronic
1028974311 7:96894684-96894706 TGGGGGCACCAGCATGGGGAGGG - Intergenic
1029033986 7:97499343-97499365 AGGGAAAACCAGATTGGGGAGGG + Intergenic
1029045276 7:97621368-97621390 TAGAAGAAACAGGATTGGGAAGG + Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029538176 7:101167828-101167850 GGGGAGAAAAAGAAAGGGAATGG + Intergenic
1029601248 7:101564760-101564782 TGGAAGAGACAGAGTTGGGAGGG - Intergenic
1030877413 7:114832173-114832195 TGGGACAACTAGAATTGGGAGGG + Intergenic
1031106858 7:117554433-117554455 TGGGAGAAACAGGTTTTGGATGG + Intronic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1032268481 7:130384282-130384304 CGGGTGAAAGAGAGTGGGGAAGG - Intronic
1032782088 7:135171492-135171514 AGGGAGAAACAGAACAGGGCAGG - Intergenic
1034053726 7:148012218-148012240 TGGTAGAAAAAGAAGGGGAAGGG - Intronic
1035044081 7:155952671-155952693 GGGGAGAAACACAGTGGGGAGGG + Intergenic
1036065299 8:5373827-5373849 AGAGAGAAACATAGTGGGGAAGG - Intergenic
1036154300 8:6327536-6327558 TGGAATAAACAGATGGGGGAAGG - Intergenic
1036714147 8:11104952-11104974 TGGTTGAAACAGGATGGTGACGG + Intronic
1037244781 8:16821260-16821282 TTGTAGAAACAGAATGCAGAAGG + Intergenic
1037352552 8:17976724-17976746 TGAGAAAAACAGAATGAGAAAGG + Intronic
1037747582 8:21659240-21659262 TGGGAGTGCCAGGATGGGGAGGG - Intergenic
1037753494 8:21697193-21697215 GGGGACAAACGGAAAGGGGAGGG + Intronic
1037757400 8:21720013-21720035 TGGGAGTAACAGAATTGGGGAGG - Intronic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039108559 8:34016916-34016938 TGGGAGAGAGACAATGGGGGAGG + Intergenic
1039337506 8:36608151-36608173 GGAGAGAAACAGATTGGGGGTGG - Intergenic
1039843531 8:41309688-41309710 GGGGAGAAAAAGAAGGGGAATGG + Intergenic
1040507240 8:48059884-48059906 AAAGAGCAACAGAATGGGGATGG - Intronic
1040787395 8:51181613-51181635 TGGGAGAGCCAGAAAGGAGATGG - Intergenic
1041166552 8:55098136-55098158 GGGGAGAGTAAGAATGGGGAAGG + Intergenic
1041279222 8:56194777-56194799 TAGGAGAAAGAGAATGGAGATGG + Intronic
1041342753 8:56863399-56863421 GGGGAAAAAGAGAAGGGGGAGGG + Intergenic
1041713497 8:60913615-60913637 GGGGAGAAATAGAGTGGAGAAGG + Intergenic
1041869858 8:62620364-62620386 TTTGAGAAACAGAATGTGCATGG - Intronic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043044617 8:75306027-75306049 TAGAAGAAACAGAATAGGGATGG + Intergenic
1043051713 8:75393673-75393695 TGTGAGAAAAAAAATAGGGAAGG + Intergenic
1043230657 8:77796081-77796103 TTGGAGTAACAAAATTGGGAAGG - Intergenic
1044175710 8:89119341-89119363 AGGAGGAAACAGAGTGGGGAGGG - Intergenic
1044206639 8:89498554-89498576 TAAGAGAAACAGAAAAGGGAGGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044538660 8:93385655-93385677 TGTGTGAAACAGAATGGACAAGG + Intergenic
1045064916 8:98436225-98436247 TGGGAGAAATGGAAGAGGGAGGG - Intronic
1045181945 8:99793680-99793702 TGAGAGACAGAGAATGGGGCAGG + Intronic
1046076210 8:109315278-109315300 TGGGAGAAACAGGAAGGGAGGGG - Intronic
1046230151 8:111345387-111345409 AGGGAGACAAAGAGTGGGGAGGG + Intergenic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047096817 8:121634770-121634792 TGGGTGAAAAATTATGGGGATGG - Intronic
1047222355 8:122928597-122928619 TGGGATAAAGAGACTTGGGAAGG + Intronic
1047508260 8:125496779-125496801 TGGGAGAAGGAGATTGGGGGTGG + Intergenic
1048135036 8:131740118-131740140 TGGGAGAGCCAGAAGGGAGATGG - Intergenic
1048705382 8:137147733-137147755 TGGGATACACACAATTGGGAAGG - Intergenic
1048744927 8:137603842-137603864 GCGGAGAAACATAATGGGTACGG - Intergenic
1048888859 8:138930780-138930802 TGGGAGAGACAGGTTGGGGCTGG + Intergenic
1048915498 8:139178927-139178949 AGGGAGAAACAGAACAGGGCAGG + Intergenic
1050578052 9:7019882-7019904 TGGGCAAAACAGAAAGTGGAGGG + Intronic
1050694845 9:8267147-8267169 TGGCTGAAACAGAATGTGAAAGG + Intergenic
1050938469 9:11427622-11427644 TGTGAGAAGCTAAATGGGGATGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051768635 9:20551366-20551388 TGTGAGAAAGAGGATGGGGTGGG - Intronic
1051963470 9:22797240-22797262 TGGTAGGAGCAGAATGGGAACGG + Intergenic
1052476081 9:28961235-28961257 TGGGAAAAAAAGGAAGGGGAAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052757854 9:32559157-32559179 GGGGAGGAACAGTTTGGGGATGG - Intronic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052986378 9:34491064-34491086 TGGGTGATACAGAATGGGAAGGG + Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053137337 9:35659422-35659444 TGGGAGAAACATAATGTAGCAGG + Exonic
1053338640 9:37302432-37302454 GGAGAGAAACAGAAAGGGAAAGG - Intronic
1053361023 9:37486592-37486614 AGGGAGTGTCAGAATGGGGATGG - Intronic
1053394547 9:37761236-37761258 TGGTTGAAACATAATGGGGGAGG + Intronic
1055252075 9:74319685-74319707 TGGGAGAGAGAAGATGGGGATGG + Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055688796 9:78807949-78807971 AGGGAGAAAATAAATGGGGAGGG - Intergenic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1056607125 9:88095277-88095299 TGAGAGCAACAGGCTGGGGAAGG - Intergenic
1056687467 9:88778333-88778355 TGGGAGAACCCGGCTGGGGAGGG - Intergenic
1056716363 9:89033822-89033844 TGGGATAAAAAGATTAGGGAAGG + Intronic
1056734045 9:89189904-89189926 TGGGAGAATCACAATGGAAATGG - Intergenic
1056989204 9:91394135-91394157 TGGGGGGATCAGATTGGGGAAGG + Intergenic
1057302826 9:93896463-93896485 GGGAAGGAACAGAATGGGCAGGG - Intergenic
1058027565 9:100158916-100158938 AGGGAGAGAGAGAACGGGGAAGG - Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058637086 9:107047725-107047747 GGGGAGAGACAGAATGAGGCCGG - Intergenic
1058639014 9:107064996-107065018 TGGTAGGAACAGAAAGGAGAGGG - Intergenic
1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG + Intronic
1059351451 9:113668182-113668204 TGGGGGAAACAGAATGGTGGTGG - Intergenic
1059461751 9:114435329-114435351 TGCAGGAACCAGAATGGGGAGGG - Intronic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1059814292 9:117894178-117894200 TGGGAGTAATATACTGGGGAAGG + Intergenic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060261273 9:122076137-122076159 TGGGACAGACAGAATGGTGGTGG - Intronic
1060689121 9:125640397-125640419 TGAGATAAACAGAATGTGGCCGG - Intronic
1061614634 9:131771876-131771898 TGGGAGGAACAGAACAGGCATGG - Intergenic
1062522930 9:136966148-136966170 CGGGAGGAAGAGAATGGGGGCGG - Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1185498141 X:574756-574778 TGGCAGAATCAGAAAGGTGACGG + Intergenic
1185575920 X:1172171-1172193 AGAGAGAAACAGAACGGGGCAGG - Intergenic
1185693855 X:2179264-2179286 AGAGAGAAACAGAACGGGCAGGG - Intergenic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1186036732 X:5431062-5431084 TGGGAAACACAGAGTTGGGATGG + Intergenic
1186074079 X:5857406-5857428 TGCGAGAGAGAGAAGGGGGAAGG + Intronic
1186420948 X:9425972-9425994 TGGGAATAGAAGAATGGGGAAGG + Intergenic
1186854613 X:13613893-13613915 TTGAAGAAAAAAAATGGGGATGG - Intronic
1187948756 X:24451718-24451740 TGGAGGAAAAAGAGTGGGGAGGG - Intergenic
1188068273 X:25687902-25687924 TAGCAAAAACAGAATGGAGAAGG + Intergenic
1188432841 X:30125685-30125707 TGGCAGAAACAGAATAATGAGGG + Intergenic
1188920534 X:35971205-35971227 TGAGGGAAGCAGAATAGGGAAGG + Intronic
1189129696 X:38485398-38485420 GGGGAGAGGCAGATTGGGGAAGG + Intronic
1189959065 X:46307555-46307577 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1190296047 X:49028633-49028655 TGGGAGAAACAGATTCCAGAAGG - Intergenic
1190440576 X:50470995-50471017 GGGGAGAGACAAAAAGGGGAGGG + Intergenic
1190711682 X:53076200-53076222 AGGAAGAAACAGAAAGGGTAGGG - Intronic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1190870077 X:54417491-54417513 GGGGACTACCAGAATGGGGAGGG + Intergenic
1192033854 X:67543910-67543932 GGGGAGAAAAGGAAAGGGGAGGG + Intergenic
1192211821 X:69132702-69132724 TGAGTGAAACAGAAAGGGCAGGG - Intergenic
1192552855 X:72067969-72067991 GGCCAGAAACAGAAAGGGGAAGG - Intergenic
1192594622 X:72393671-72393693 TGGGAAAAGGAGGATGGGGAGGG + Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193536710 X:82725967-82725989 TGGGAGAAACAGAATTGTTTGGG + Intergenic
1193791332 X:85818860-85818882 TGGGAGAAACAAAAAAGGGATGG + Intergenic
1193801534 X:85942708-85942730 TGGGAGGAAACCAATGGGGATGG + Intronic
1194014771 X:88605523-88605545 TGGGAGTAACAGGGTGGGGTAGG - Intergenic
1194610389 X:96035952-96035974 AGGAAGAAATAGAATGGTGAAGG - Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1196072302 X:111539336-111539358 TGGGGGAACCAGAAGGGAGATGG - Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196331610 X:114476797-114476819 AGGGAAAAATAGAATGGGGATGG + Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197287019 X:124607608-124607630 TGGGAGAAGCAGATTGGGTAGGG + Intronic
1197467182 X:126819634-126819656 AGGGAGAAAAGGAGTGGGGAGGG - Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1197886092 X:131219983-131220005 TGGGAGAAGGGGAATGGTGAGGG + Intergenic
1198487704 X:137104902-137104924 TGGAAGAAACTGAAGCGGGAAGG - Intergenic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200035353 X:153324336-153324358 TGGGATAGAGAAAATGGGGAAGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200627093 Y:5532792-5532814 AGAGAGAAACAGAAAAGGGAAGG - Intronic
1201342242 Y:12947182-12947204 TAGGAGAACCAGGATGGGCATGG - Intergenic