ID: 1029412766

View in Genome Browser
Species Human (GRCh38)
Location 7:100426551-100426573
Sequence ATACTGTTATTAATGCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 380}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029412766 Original CRISPR ATACTGTTATTAATGCAAAA AGG (reversed) Intronic
902829592 1:19003077-19003099 AGACATTTATTAATGAAAAAGGG + Intergenic
904020126 1:27457522-27457544 TTATTGTTATTAAGACAAAACGG + Intronic
904389257 1:30170620-30170642 ATTGTGGTATAAATGCAAAATGG + Intergenic
904889621 1:33769997-33770019 ATAATGTTATCAATAGAAAAGGG - Intronic
907549383 1:55291507-55291529 TTACTTTTATTACTGCAAAGAGG + Intergenic
908109794 1:60885360-60885382 ATAATGTGATCAAGGCAAAATGG - Intronic
909016051 1:70380772-70380794 TTACTGATATTAATTTAAAAAGG + Intronic
909928779 1:81470877-81470899 ATAAAGTCATTAATGCACAAAGG + Intronic
910038379 1:82817106-82817128 GTACTGTGATAATTGCAAAATGG - Intergenic
910661789 1:89681368-89681390 TTAATGTTTTTGATGCAAAAAGG - Intronic
911232598 1:95376881-95376903 ATAGTGGAATTAATGCTAAAAGG + Intergenic
911565627 1:99460421-99460443 ATACTGCTATATATGCATAATGG + Intergenic
913552582 1:119930465-119930487 ATTCTATGATTAATTCAAAAAGG + Intronic
914316474 1:146517315-146517337 ATACGATCATTAATGCCAAAGGG - Intergenic
914497882 1:148216046-148216068 ATACGATCATTAATGCCAAAGGG + Intergenic
915292361 1:154894841-154894863 ATACAGAAATTAATTCAAAATGG + Intergenic
915738800 1:158102198-158102220 ATCCTGTTATCAAAGCAGAAGGG - Intergenic
916158410 1:161881929-161881951 ATACAGAAATTAATTCAAAATGG - Intronic
916274797 1:162982143-162982165 ACGCTGTTGTTAATGCAATAGGG - Intergenic
916395076 1:164377795-164377817 ATACTGTGAATATTGAAAAAGGG - Intergenic
917672941 1:177290831-177290853 ATACAGTAATTAAAACAAAATGG - Intergenic
917875524 1:179283288-179283310 ATTCTGTTACTAAAGAAAAAGGG + Intergenic
917988320 1:180345693-180345715 ACAATATTATTAATGTAAAATGG + Intronic
918562439 1:185885996-185886018 ATACTTTTTTTAATTTAAAAAGG - Intronic
919071302 1:192758613-192758635 TTGCTGTTAGGAATGCAAAATGG - Intergenic
921587774 1:216967841-216967863 TTACTGATAGGAATGCAAAATGG - Intronic
921775521 1:219095844-219095866 ATACTTGTATTAATTCTAAAGGG - Intergenic
922418063 1:225439609-225439631 ATACTATTATTATTGCAATAGGG - Intergenic
923729765 1:236538980-236539002 ATACTTTGATAAATGAAAAATGG + Exonic
924449813 1:244167444-244167466 ATACTGATATTAGTAAAAAATGG + Intergenic
924664348 1:246055239-246055261 TTACTGGTAGGAATGCAAAACGG + Intronic
1063037058 10:2296825-2296847 ATACTGTAAGCAATGGAAAAGGG - Intergenic
1063615358 10:7595592-7595614 ATAGTGTTTTTAAAGCAAATAGG - Intronic
1063673697 10:8120648-8120670 ATACTGTATTCAATGGAAAATGG - Intergenic
1063815171 10:9763141-9763163 ATAATGAAATTATTGCAAAATGG - Intergenic
1064490333 10:15849232-15849254 ATACCTTAATTAAAGCAAAAAGG + Intronic
1064846650 10:19662908-19662930 ATTCTATGATTAATGAAAAATGG - Intronic
1064978474 10:21143051-21143073 ATCCTTTTATTAATTCAACAAGG + Intronic
1065063728 10:21936698-21936720 AAACTGGTATTAATCCAAACTGG + Intronic
1065168845 10:23008133-23008155 ATACTGTTTTTAAAGTATAAAGG - Intronic
1065202394 10:23325821-23325843 ATGCTGTAATAAATGAAAAAAGG + Intronic
1065265827 10:23974447-23974469 ATGCGGTTATTAATTTAAAAGGG + Intronic
1065351582 10:24800320-24800342 ATAATTTTATAAATGCAAAGGGG + Intergenic
1065461727 10:25973926-25973948 ATACAGAAATTAATGCAAGATGG + Intronic
1065664617 10:28044557-28044579 ATTATATTATTAATGCAAAAAGG - Intergenic
1068024206 10:51622557-51622579 ATACGGTCATTAATTGAAAACGG + Intronic
1068026685 10:51654182-51654204 ATACAAATATTAATTCAAAATGG - Intronic
1068434362 10:56971583-56971605 ATATTGTTATTTATGAAAAGTGG + Intergenic
1068444027 10:57096539-57096561 ATACTGTGAATAATGCTACAAGG - Intergenic
1069231758 10:66019000-66019022 ATACATTTATTAATGCCATATGG - Intronic
1069517947 10:69094530-69094552 AAACTATTATTCATGCAAAGAGG + Intronic
1070408609 10:76118706-76118728 GTGATGTTTTTAATGCAAAAGGG - Intronic
1071605750 10:86987042-86987064 CTACTATTAGTAATGCACAAAGG + Intergenic
1072920935 10:99576781-99576803 ATACTTTTATAAAAGCAAAATGG - Intergenic
1072973941 10:100041388-100041410 ATAATGTTTTTAGTGCAAATGGG + Intergenic
1073775440 10:106780533-106780555 ATACTGTTGTAAATGAATAAAGG + Intronic
1073979614 10:109140127-109140149 ATACTGTGATATATTCAAAAGGG - Intergenic
1074667152 10:115741188-115741210 AATATGTTATTAATGCCAAAAGG + Intronic
1075433423 10:122410715-122410737 ATACTGTAATTTAAGAAAAATGG + Intronic
1075771077 10:124936441-124936463 ATAGTGTCATTAATGGAAACTGG + Intergenic
1078801800 11:14653065-14653087 ATACTATAAATAATTCAAAAAGG - Intronic
1079306855 11:19330918-19330940 ATACTGTTATTTATCCTAAGTGG + Intergenic
1079877514 11:25878235-25878257 ATACAATAATTAATGCAAGATGG - Intergenic
1080247755 11:30198671-30198693 ATAGTGTGATTTATGCAAGAAGG - Intergenic
1080329740 11:31122136-31122158 ATTCTGGAATTAATGCAAGATGG + Intronic
1080355066 11:31433923-31433945 ATACTGTTATTGAGACACAAGGG - Intronic
1080991060 11:37535496-37535518 ATTCTGTTCTTAATACAAACTGG + Intergenic
1082589631 11:54989979-54990001 ATACAGTAATTAATTCAAGATGG + Intergenic
1082620671 11:55417768-55417790 ATACTGATCTAGATGCAAAAAGG - Intergenic
1083157012 11:60829629-60829651 ATACTTTCATGAATGCAAATGGG + Intergenic
1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG + Intergenic
1085768213 11:79302543-79302565 ATAATGCTAATAATGCAAATTGG - Intronic
1086267873 11:85023519-85023541 ATATTTATATTAATTCAAAATGG - Intronic
1086826287 11:91503230-91503252 ATACTCCTATTATTTCAAAAAGG + Intergenic
1087136279 11:94723740-94723762 GTACTTTTATTCATGTAAAAAGG + Intronic
1088078463 11:105880220-105880242 AAAATGTTATTAAATCAAAATGG + Intronic
1088591026 11:111403384-111403406 ACACTGTAATTAATGGAGAAAGG + Intronic
1089965953 11:122655403-122655425 ATGCGGTTATTAATGGAAATTGG - Intergenic
1091064309 11:132494174-132494196 ATACTTTTGTAAATGCAAGAAGG + Intronic
1093685479 12:22049003-22049025 ATTCTGTTACTACTGCAACAGGG - Intronic
1094167754 12:27459948-27459970 ATTCTGTTATGACAGCAAAAGGG + Intergenic
1095325828 12:40890944-40890966 CTACTGGTAGAAATGCAAAATGG - Intronic
1095722432 12:45415084-45415106 ATTCTGTTAGTAATCCCAAATGG - Intronic
1096443182 12:51663664-51663686 ATTCTGTTATTCATGCAAGTAGG + Intronic
1097643950 12:62213976-62213998 ATACTGGTAATGATGCAAACTGG - Intronic
1097932115 12:65199871-65199893 TTACTGGTAGGAATGCAAAATGG - Intronic
1097998433 12:65915460-65915482 ACACTGTGATTTCTGCAAAAAGG - Intronic
1098020307 12:66148849-66148871 ATACTGTAATTAAGGGGAAAGGG - Intronic
1098038390 12:66329729-66329751 ATACTATTATTAATACTTAATGG - Intronic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1099788040 12:87292647-87292669 ATGCTATAATTAATGCAAACAGG + Intergenic
1100046595 12:90389153-90389175 ATACAATAATTAATTCAAAATGG + Intergenic
1102209440 12:111114184-111114206 TTACTGGTAGAAATGCAAAATGG - Intronic
1105729287 13:23195962-23195984 ATACTATTTTAAATGAAAAAAGG + Intronic
1106304807 13:28500258-28500280 ATACAGTTATGAGTGCTAAAAGG + Intergenic
1106923020 13:34584880-34584902 ATCATGTTATTTATGCTAAATGG - Intergenic
1107719496 13:43232962-43232984 ATATTGTTATAAAGGAAAAATGG - Intronic
1108533809 13:51351794-51351816 ATACAATAATTAATTCAAAATGG - Intronic
1109236026 13:59821762-59821784 AAACTGTTATCAATGAAAATAGG + Intronic
1109640491 13:65185174-65185196 ATACAGAAATTAATTCAAAATGG + Intergenic
1109804642 13:67422438-67422460 ATACTATTATTAATCACAAAGGG - Intergenic
1110381406 13:74855778-74855800 CTACTGCTATTTATGTAAAAAGG - Intergenic
1110482751 13:76000198-76000220 ATACTGCAATGCATGCAAAAAGG + Intergenic
1110588215 13:77220742-77220764 ACTCTGTTATTAATTCAGAAAGG - Intronic
1111142728 13:84142333-84142355 ATACTGTTGGGAATGCAAAATGG - Intergenic
1111252885 13:85627716-85627738 AGAATCTTATTAATGTAAAATGG + Intergenic
1111278559 13:85987316-85987338 TTACTGGTAGGAATGCAAAATGG - Intergenic
1111620450 13:90718078-90718100 ATTTTGGTAGTAATGCAAAAAGG - Intergenic
1112638870 13:101248782-101248804 ACATTTTTATTAAAGCAAAAAGG - Intronic
1112763221 13:102713604-102713626 AAACTGGTAGCAATGCAAAATGG + Intergenic
1113072814 13:106438283-106438305 AAACTGATGTGAATGCAAAATGG - Intergenic
1114068556 14:19088618-19088640 CTACTATTAGTAATGCACAAGGG - Intergenic
1114093708 14:19311396-19311418 CTACTATTAGTAATGCACAAGGG + Intergenic
1116513381 14:45774975-45774997 ATACAGATATTAACTCAAAATGG - Intergenic
1116907878 14:50423215-50423237 AAATTGTTATTAAGGCAATATGG - Intronic
1117036309 14:51733334-51733356 TTACTGTCATTACTGCAAGATGG + Intergenic
1118334214 14:64838247-64838269 ATACAGAAATTAATTCAAAATGG + Intronic
1118995819 14:70835083-70835105 ATACTGTTTTAAATGCATTATGG + Intergenic
1119990511 14:79191614-79191636 TTACTGTCATCAATGCTAAAAGG - Intronic
1120623862 14:86800202-86800224 ATACTATAATTGATACAAAAAGG + Intergenic
1124090595 15:26596273-26596295 AAACAGTTATAAATGAAAAAGGG + Intronic
1127805195 15:62512853-62512875 ATACTGTTACCAATCCAAACAGG - Intronic
1128193782 15:65731470-65731492 TTGCAGTTATTAATGAAAAAAGG - Intronic
1129309218 15:74694161-74694183 ATTCTGTAATTAATACAAAATGG - Intronic
1129647779 15:77453468-77453490 TTACTGGTATGAATGTAAAATGG + Intronic
1130745574 15:86650172-86650194 ATTCTGTTACTAATGAAGAATGG - Intronic
1131267837 15:90928416-90928438 ATAATTTTATGAATGCAAATTGG + Intergenic
1133542524 16:6770321-6770343 ATAATGTATTTAATGCAACAGGG + Intronic
1135713930 16:24744317-24744339 ATAGTGTTATTAATTACAAAGGG - Intronic
1140550809 16:75863385-75863407 ATCATATTATTATTGCAAAAGGG - Intergenic
1140930372 16:79622242-79622264 ATATTGTTAAAAATTCAAAAGGG + Intergenic
1141026587 16:80554488-80554510 ATGCTGTTATGAATCCAAGAGGG - Intergenic
1141306416 16:82868253-82868275 AAACTCTTATTAATGTAAATAGG - Intronic
1143945123 17:10584600-10584622 ATACTGTTTTAAATGCAGAGGGG - Intergenic
1144650598 17:17004617-17004639 AGATTGTTATTTCTGCAAAATGG + Intergenic
1149278963 17:55080374-55080396 ATAATGATATTAATTCACAAAGG - Intronic
1150372599 17:64653428-64653450 ATGCTGGTAGAAATGCAAAATGG + Intronic
1150779728 17:68111402-68111424 ATGCTGGTAGAAATGCAAAATGG - Intergenic
1151229586 17:72674269-72674291 ATACTGTCACTGATGTAAAAAGG - Intronic
1151859470 17:76749185-76749207 ATACTTTTATTACCCCAAAAAGG + Intronic
1154127501 18:11704659-11704681 ATACTGATATTAAGGAAGAAAGG - Intronic
1155012467 18:21793434-21793456 ACACAGTTATTATTGAAAAAAGG + Intronic
1155133912 18:22967986-22968008 ATAATTTTTTTAATGCCAAAAGG + Intronic
1156153827 18:34277428-34277450 ATGATGTTAATAAGGCAAAAAGG - Intergenic
1156220355 18:35044659-35044681 ATACTGTTGTTACTGAAAAAGGG + Intronic
1156346308 18:36260099-36260121 ATATTATTATCAATGGAAAAAGG + Exonic
1156951215 18:42900662-42900684 ACACTGATATTAATGAAAAGAGG - Intronic
1157235174 18:45958645-45958667 ATACAAAAATTAATGCAAAAAGG + Intronic
1157637447 18:49172951-49172973 ATACACATATTAATGCAAAATGG - Intronic
1157996043 18:52557288-52557310 GTACTGTTTTAAATGCATAATGG - Intronic
1158461442 18:57649491-57649513 ATACTGTTGGCACTGCAAAAGGG + Intronic
1158987597 18:62834611-62834633 ACACTGATGTGAATGCAAAATGG - Intronic
1160282516 18:77504955-77504977 ATACAGAAATTAATGCAAAATGG - Intergenic
1165470764 19:36003218-36003240 ATTCTGTTCTCAAGGCAAAAGGG + Intergenic
1167222289 19:48208092-48208114 TTAATGTTATTAAAACAAAAAGG - Exonic
925238743 2:2302938-2302960 ATACATGTATTTATGCAAAAGGG - Intronic
925520715 2:4741534-4741556 TTACTGGTAGAAATGCAAAATGG + Intergenic
927421718 2:22940540-22940562 AAACTTTTAGAAATGCAAAAAGG + Intergenic
927742863 2:25588306-25588328 ATGTTGTTATAAATGCAGAAAGG - Intronic
929649789 2:43666551-43666573 TTACTGGTAGGAATGCAAAATGG - Intronic
929703073 2:44181674-44181696 ATGCTGTTACTAATACAAATAGG + Intronic
931483151 2:62663362-62663384 AAACTGTTCTTGATGCAAAAAGG + Intergenic
931647770 2:64440821-64440843 ATACTGTAAATAATTCACAAAGG - Intergenic
931663222 2:64589200-64589222 ATACAGAAATTAATTCAAAATGG - Intronic
931973987 2:67622696-67622718 AAGCTGTTATTAATGCAAATTGG + Intergenic
932135212 2:69222865-69222887 AAACTGTAATTTATGCAGAATGG - Intronic
932517400 2:72367188-72367210 ATTCTTACATTAATGCAAAATGG + Intronic
933313146 2:80685404-80685426 ATATTGTTAATAATAAAAAATGG - Intergenic
933430736 2:82174656-82174678 ATACTGTTGTTAATTCCATATGG + Intergenic
938236993 2:129713186-129713208 CCAGTGTTATCAATGCAAAAAGG + Intergenic
939237059 2:139508293-139508315 TTACTGTTAGAAATGGAAAATGG + Intergenic
939325794 2:140686560-140686582 ATACTTTTATTGATGAAAATAGG + Intronic
940483767 2:154271568-154271590 TGAATGTTATTAATGCAAGAGGG - Intronic
940852561 2:158702455-158702477 TTATTATTATTATTGCAAAAGGG - Intergenic
941357045 2:164506499-164506521 TTACTGGTAGGAATGCAAAATGG + Intronic
941839947 2:170071117-170071139 TTACTGATAGGAATGCAAAACGG + Intronic
942179712 2:173368704-173368726 ATACCTTGATTAATGCAAAGAGG - Exonic
942494193 2:176521792-176521814 ACAATTTTATTAATGAAAAATGG - Intergenic
943978715 2:194517772-194517794 ATGCTGTTAGAAATGCTAAATGG + Intergenic
944025623 2:195163005-195163027 TGACTGTTATTAATTCCAAAAGG - Intergenic
944216960 2:197265845-197265867 ATACTGCTAATAAAGCCAAAGGG - Intronic
944424070 2:199561224-199561246 ATACTGAAATTAATTCAAGATGG - Intergenic
944821005 2:203430937-203430959 AAACAGTTCTTAATGCAGAAAGG - Exonic
945373388 2:209049565-209049587 ATTCTATTATAAATGCAATAGGG + Intergenic
945806320 2:214494087-214494109 ATACTGTAATTGTAGCAAAATGG - Intronic
946756974 2:222957029-222957051 ATACTGAAATAAATTCAAAATGG - Intergenic
946805787 2:223470189-223470211 ATACTGAAGTTAATACAAAAGGG + Intergenic
946954427 2:224913257-224913279 ATATTGTTATTATTGCTAAATGG + Intronic
947067271 2:226241771-226241793 TTGCTGGTATGAATGCAAAATGG - Intergenic
947284672 2:228500332-228500354 ACACTTTTTTTAATGAAAAAGGG - Intergenic
947367405 2:229411101-229411123 GTACTGTGATAAATACAAAAAGG - Intronic
1169787346 20:9373878-9373900 AGACTCTTGTTAATCCAAAATGG + Intronic
1169968721 20:11246082-11246104 TTATTGTTATTAAAGAAAAATGG + Intergenic
1170839661 20:19914078-19914100 ATACTGTTATTAAAGCCACCTGG - Intronic
1173039206 20:39445013-39445035 ATACTCTGATAAATGTAAAAGGG - Intergenic
1174564652 20:51456227-51456249 ATACTTTAATAAATGAAAAATGG + Intronic
1174622022 20:51882886-51882908 ATACAGAAATTAATTCAAAATGG + Intergenic
1174714334 20:52741057-52741079 ATTCTTTTATTCTTGCAAAATGG + Intergenic
1176674269 21:9763245-9763267 ATACTGAAATCCATGCAAAATGG - Intergenic
1177408511 21:20700668-20700690 TTACTGGTAGGAATGCAAAATGG + Intergenic
1177920581 21:27147540-27147562 ATAGTCTTTTTAATGGAAAAGGG - Intergenic
1179202605 21:39239793-39239815 TTACTGATAGGAATGCAAAATGG + Intronic
1180487028 22:15811179-15811201 CTACTATTAGTAATGCACAAGGG - Intergenic
1180579623 22:16819593-16819615 CTACAGAAATTAATGCAAAATGG + Intronic
1182203012 22:28592661-28592683 ATACTGTCATGAATACAGAAGGG - Intronic
1182401617 22:30081926-30081948 ATACAAATATTAATGCAAAATGG - Intronic
1183761508 22:39823761-39823783 TTACTGGTAGGAATGCAAAATGG - Intronic
1184926176 22:47640544-47640566 ATATTATTAAAAATGCAAAAAGG + Intergenic
949167782 3:961590-961612 ATACTTTAATTAAAGAAAAATGG - Intergenic
949216140 3:1569696-1569718 ACACTGTTATAAATATAAAAAGG - Intergenic
949328162 3:2890609-2890631 AAAATGGTTTTAATGCAAAATGG - Intronic
949446403 3:4138750-4138772 ACAATTTTATTATTGCAAAAAGG - Intronic
950757023 3:15182739-15182761 ATACAGTTATTAATTCACTAGGG - Intergenic
950927130 3:16752645-16752667 ATATTTTTATTACTGTAAAATGG + Intergenic
951215520 3:20021219-20021241 TTACTGGTGTGAATGCAAAATGG + Intergenic
955021031 3:55121212-55121234 AAACTTTTATTAGTGGAAAAGGG + Intergenic
955055864 3:55455741-55455763 ATACTGTAATTAATTCAGCAAGG + Intergenic
955233612 3:57121123-57121145 ATTCTGTGATTAATGCTGAACGG - Intronic
955282039 3:57602873-57602895 AAACTTTTATAAATGCTAAATGG - Intergenic
955588504 3:60508448-60508470 AAACTGTTATTACTGAATAATGG + Intronic
956416506 3:69036440-69036462 AAACTGTCATTTATGTAAAAAGG + Intronic
956985956 3:74701008-74701030 TTACTTTTATTCATGCAAATAGG + Intergenic
957766833 3:84636286-84636308 ATATCATTAATAATGCAAAATGG - Intergenic
957892197 3:86374828-86374850 ATAATATCATTAATGCAAAATGG - Intergenic
958009633 3:87860151-87860173 AGAATGTTATTAATGTAAAATGG - Intergenic
958010886 3:87878032-87878054 ATAGTGGTTTTAATGAAAAAGGG + Intergenic
958725274 3:97897769-97897791 AGACTTTTCTTAATTCAAAAAGG + Intronic
959405379 3:105956360-105956382 ATACTTGTATTAATGCACACCGG - Intergenic
959909673 3:111749743-111749765 ATACTATTGTTAAAGAAAAAAGG - Intronic
960313398 3:116145260-116145282 AAACTGTGACTAATACAAAATGG - Intronic
960698926 3:120421888-120421910 ATACAATTATAAATGCAAATTGG + Intronic
963812821 3:149796217-149796239 TTACTGGTGGTAATGCAAAATGG - Intronic
963860950 3:150309736-150309758 ATGCTGGTAGGAATGCAAAATGG - Intergenic
964547575 3:157851254-157851276 AGAGTGTTACAAATGCAAAAGGG + Intergenic
964870116 3:161304359-161304381 ATATTAATATTAATCCAAAATGG + Intergenic
965277432 3:166703818-166703840 ATACTGTTATATATGCAAGTAGG + Intergenic
965688988 3:171335093-171335115 AGAATCTTTTTAATGCAAAAGGG + Intronic
965696005 3:171408878-171408900 ATATTGTTATTAGTGCCAATCGG + Intronic
965845535 3:172956844-172956866 ATATTGTTATTGATGCCAAATGG - Intronic
966551252 3:181206495-181206517 ATACTGATGAAAATGCAAAATGG - Intergenic
967874699 3:194259912-194259934 AATCTGTTATTAAGGAAAAAGGG - Intergenic
970694217 4:18657474-18657496 ATACCTATATTAATGCAGAAAGG + Intergenic
970764358 4:19529582-19529604 ATCCTGTTATTTGTGCAACATGG + Intergenic
970795339 4:19905430-19905452 ATATTGTCAGTAATTCAAAAAGG + Intergenic
971525292 4:27609469-27609491 ATACAGGTATTAATACTAAATGG + Intergenic
972103593 4:35453285-35453307 ATGCTATTAGGAATGCAAAATGG + Intergenic
972352361 4:38247510-38247532 TTACTGTCAGAAATGCAAAACGG - Intergenic
972519739 4:39842261-39842283 TTAATGTTATTAAGGCAAAATGG - Intronic
972718874 4:41675773-41675795 AACCTTTTATTAATACAAAAAGG + Intronic
973084386 4:46037176-46037198 GTACTGTTCTAAATACAAAAGGG - Exonic
973297260 4:48538451-48538473 TTACTCTTATTAATGCTAATGGG + Intronic
974483065 4:62470799-62470821 AAACTATTATTAATGTTAAATGG - Intergenic
975055045 4:69919526-69919548 AGACTCTTGTTAATGGAAAAGGG - Intergenic
975226002 4:71872640-71872662 ATACTATAATAAAAGCAAAATGG - Intergenic
975563760 4:75732519-75732541 ATAATGTTTTTAATGAAATAAGG - Intronic
976770224 4:88644168-88644190 TTGCTGGTGTTAATGCAAAATGG + Intronic
976896003 4:90112712-90112734 ATACTATAATAGATGCAAAATGG - Intergenic
977550366 4:98435780-98435802 ATACCGATATTAACTCAAAATGG - Intronic
978011493 4:103691024-103691046 TTGCTGTTATGAATACAAAATGG + Intronic
978091383 4:104720642-104720664 ATACTTTTATTAATACTATAAGG + Intergenic
978474971 4:109116276-109116298 ATGCTGTTGTTATTTCAAAATGG - Intronic
978496729 4:109367515-109367537 ATACTGTGAATAATGCAAATAGG + Intergenic
978962806 4:114704172-114704194 AAAAGTTTATTAATGCAAAAAGG + Intergenic
979140240 4:117162964-117162986 ATATTTTTATTATAGCAAAAAGG + Intergenic
979830318 4:125292509-125292531 ACACTGGTATAAATGCAAAATGG + Intergenic
980173491 4:129317173-129317195 ATACAAATATTAATTCAAAATGG - Intergenic
980306015 4:131062488-131062510 ATATGTTTATTAATGGAAAAGGG - Intergenic
980712544 4:136589612-136589634 AGATTGTTTTAAATGCAAAAAGG + Intergenic
981896548 4:149808553-149808575 ATAATGTTCTTAACACAAAAAGG + Intergenic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
984778182 4:183502560-183502582 ATCCTGTGAATAAAGCAAAAAGG - Intergenic
986000932 5:3630014-3630036 TTTCTGTTAATAATGCAAGAAGG - Intergenic
986795907 5:11211717-11211739 ATTCTTTTGTTCATGCAAAATGG + Intronic
987550052 5:19367828-19367850 ATGTTATTATTAATGCAAAGGGG + Intergenic
987588199 5:19886987-19887009 ATACTGTTATTGATGTATATTGG + Intronic
988094029 5:26579715-26579737 ATACTGTTAAAAATGCCAAAAGG - Intergenic
988896569 5:35680738-35680760 TTAAAGGTATTAATGCAAAACGG + Intronic
989219899 5:38945915-38945937 ATAGTGTTTTAAATACAAAATGG + Intronic
989498789 5:42141168-42141190 ATAGTTTTATTAATTCCAAAAGG - Intergenic
989726453 5:44592358-44592380 ATACTGTTATTATAGCCAATTGG + Intergenic
990147030 5:52773672-52773694 ATTTTGTTATATATGCAAAAAGG - Intergenic
990189015 5:53237419-53237441 ATGCTGTTTTGAAGGCAAAAAGG + Intergenic
990974399 5:61545546-61545568 ATAATGTTATTTGTGCACAAAGG - Exonic
991108838 5:62874484-62874506 TTGCTGGTATGAATGCAAAATGG + Intergenic
992518207 5:77519130-77519152 TTACTGTAATGAATACAAAAAGG + Intronic
993831663 5:92767605-92767627 ATACATTTATTTATGAAAAAAGG - Intergenic
993975867 5:94479697-94479719 TTGCTGTTAGGAATGCAAAATGG - Intronic
994052365 5:95377218-95377240 ATACAGTGATTATTTCAAAAGGG + Intergenic
994219340 5:97176894-97176916 AAATTGTTACTAATGCATAAGGG - Intronic
994438761 5:99773980-99774002 ATACTTTTGCTAATACAAAAAGG - Intergenic
994447256 5:99892955-99892977 ATTTTGCTATTAATGCAATATGG - Intergenic
994458188 5:100041303-100041325 ATACATATATTAATGAAAAAGGG + Intergenic
994703222 5:103164215-103164237 ATAATGTTATGAAAGAAAAAGGG - Intronic
995366833 5:111371266-111371288 ACACTGTTGCTAATACAAAATGG - Intronic
995398082 5:111710240-111710262 ATATGTTTATTAATTCAAAATGG - Intronic
996807632 5:127475340-127475362 CTGCTGTTAAGAATGCAAAATGG - Intergenic
1000581841 5:163044353-163044375 ATAATGTTATAAATGAAAATGGG + Intergenic
1002577935 5:180187253-180187275 ATATAATTATTAATTCAAAATGG + Intronic
1003929591 6:10911071-10911093 CTACTGTTACTACTGGAAAAAGG + Intronic
1004461278 6:15838846-15838868 ATACTGGTATATATCCAAAAAGG + Intergenic
1004539135 6:16532779-16532801 TTACTGATAGAAATGCAAAATGG + Intronic
1005297968 6:24445409-24445431 AGAATGTTATTAATGAAAAAAGG + Intronic
1008015629 6:46516074-46516096 CTACTGTGAATAATGCATAAGGG + Intergenic
1009221970 6:60994209-60994231 ATACTGTTTTTAATGCCCAGGGG + Intergenic
1010079799 6:71847498-71847520 ATTCTGTCCTTAATACAAAAAGG - Intergenic
1010089921 6:71968729-71968751 ATCATGTTATTGATGCTAAAAGG + Intronic
1010110382 6:72221449-72221471 CAACTGTAAATAATGCAAAATGG + Intronic
1010793890 6:80096655-80096677 ATACTTTTATGAAGACAAAAGGG - Intergenic
1011465969 6:87657560-87657582 ATTCTGTTAGTATGGCAAAAAGG + Intronic
1011815362 6:91183827-91183849 ATACTAAAATTAATGCAAGATGG - Intergenic
1012097750 6:94985816-94985838 ATACTGTGAATAATGACAAATGG - Intergenic
1012477207 6:99626936-99626958 ATACAAAAATTAATGCAAAATGG + Intergenic
1012592166 6:100995547-100995569 ATACTGTTAGAAATCCTAAAGGG - Intergenic
1013739003 6:113261034-113261056 ATAATGTTGATAATGAAAAAAGG + Intergenic
1014165134 6:118215661-118215683 ATACTTTTATTAATGTAAAATGG + Intronic
1014276151 6:119392224-119392246 CTACTGTAAATAATACAAAAAGG - Intergenic
1014626483 6:123732025-123732047 ATACTTTTATAATTGCAACAAGG - Intergenic
1015992095 6:138956051-138956073 ACACTCATATTAATGCATAAAGG - Intronic
1016130305 6:140460153-140460175 CTACTCCTATTAAGGCAAAATGG - Intergenic
1016226166 6:141741107-141741129 CTGCTGTTAGGAATGCAAAATGG - Intergenic
1017782873 6:157730063-157730085 ATACTTTCATTACTCCAAAAAGG - Intronic
1020356334 7:7279759-7279781 AAACTGTTATTTATGCATGAAGG + Intergenic
1020872597 7:13650594-13650616 ATACTCCTATGGATGCAAAAAGG + Intergenic
1021151157 7:17152115-17152137 TTACTGGTAGGAATGCAAAATGG + Intergenic
1021831110 7:24610869-24610891 ATACTGTAAGTTATGCAACATGG + Intronic
1023120852 7:36906933-36906955 ATATTGTTGTTAAAGCAATAGGG - Intronic
1023903478 7:44503461-44503483 TTACTGATAGGAATGCAAAATGG - Intergenic
1024503521 7:50140512-50140534 AAACTGTTATAATTGCAGAAGGG + Intronic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1024941943 7:54772457-54772479 ATACTATTAATAATATAAAAAGG + Intergenic
1028891918 7:95997555-95997577 ATACTAGTATTAATTGAAAAGGG + Intronic
1029412766 7:100426551-100426573 ATACTGTTATTAATGCAAAAAGG - Intronic
1029608238 7:101612777-101612799 ATACAGTTAAGAATGCAAAAAGG - Intergenic
1029947227 7:104545464-104545486 ATACTGTAATTCAAGCAAACAGG - Intronic
1030074892 7:105728329-105728351 ATACTGTTATTCATGCATATTGG + Intronic
1031841715 7:126749881-126749903 TTGCTGTTAGTGATGCAAAATGG + Intronic
1032176012 7:129626680-129626702 ATGCTGTGATGAATACAAAAAGG + Intronic
1032959304 7:137012504-137012526 ATAATTTTATTTAAGCAAAAAGG - Intronic
1036583223 8:10097434-10097456 ATCCTGTAATCAATTCAAAAAGG - Intronic
1037186643 8:16072097-16072119 ATGCTGTTGTTAATGTAAATTGG + Intergenic
1037663547 8:20947193-20947215 ATGCTGCTATGAATGTAAAATGG + Intergenic
1038127120 8:24686860-24686882 ATACTTTTATAGCTGCAAAATGG + Intergenic
1038640883 8:29325385-29325407 ATACTATGAATAATACAAAATGG - Intergenic
1038918879 8:32059734-32059756 ATATTGTAATAAGTGCAAAAAGG - Intronic
1039002683 8:32998817-32998839 ATAATGATATTAATTCATAAGGG - Intergenic
1039111561 8:34045848-34045870 ATCCTGTGATTAAGGCAGAAGGG + Intergenic
1039134420 8:34304083-34304105 AAAGTTTTTTTAATGCAAAATGG - Intergenic
1039172311 8:34761505-34761527 ATACTGGGGTTAAGGCAAAAAGG + Intergenic
1039784086 8:40817209-40817231 ATTCTTTTAATAATGTAAAAAGG - Intronic
1040673748 8:49724190-49724212 TTGCTGTTGTGAATGCAAAATGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042209135 8:66360928-66360950 ATTCAGTTATTAGGGCAAAAAGG - Intergenic
1042309142 8:67363165-67363187 ATGCTATTATTTATGCAAAATGG + Intergenic
1042446007 8:68885796-68885818 ACACAGATATTAATTCAAAATGG + Intergenic
1043935991 8:86143272-86143294 ATACTGTTGTTACTGGAAAAGGG + Intronic
1043947557 8:86271639-86271661 ATAATTTTATTAATTCAAAATGG + Intronic
1044104215 8:88182600-88182622 CTGCTGGTAATAATGCAAAATGG + Intronic
1044203981 8:89470162-89470184 ATATTGTCTTTAATGCAAGATGG - Intergenic
1044270142 8:90232430-90232452 ATACAGAAATTAATTCAAAATGG - Intergenic
1045284830 8:100781501-100781523 ATGGTATTATTAATGCTAAAAGG + Intergenic
1046574511 8:116009741-116009763 ATACTGTAATGAATACAATATGG - Intergenic
1047243548 8:123117374-123117396 AGACAGTTATTAATGGCAAATGG + Intronic
1047260635 8:123256460-123256482 ACACTATTATTAATGTGAAATGG + Intronic
1047377184 8:124311306-124311328 ATTCTGTTACTAAAGCAAACAGG - Intergenic
1047644423 8:126854919-126854941 TTTCTGCTATTACTGCAAAAAGG + Intergenic
1048404178 8:134102786-134102808 CTACTGGTAAGAATGCAAAATGG + Intergenic
1048759368 8:137775607-137775629 TTACTGTTACTAATGGAAAAAGG + Intergenic
1050039754 9:1476754-1476776 TTACTGTTTCTAATGGAAAATGG + Intergenic
1050978458 9:11973930-11973952 ATAATGTTATTTATAAAAAAGGG - Intergenic
1051069166 9:13142298-13142320 ATACTGTGAGTAAATCAAAATGG + Intronic
1051323047 9:15931163-15931185 GTACAGCTATTAATGGAAAACGG - Intronic
1051459647 9:17296604-17296626 CTAATGTTATTAGTGAAAAATGG + Intronic
1051940861 9:22504031-22504053 ATACTAAAATTAATTCAAAATGG - Intergenic
1052120118 9:24704109-24704131 ATACAATAATTAATTCAAAATGG + Intergenic
1052521612 9:29555106-29555128 ATATGGTTATTAAAGAAAAAAGG + Intergenic
1054737095 9:68765428-68765450 AAATTTTTATTAATGCAACATGG + Intronic
1055128335 9:72745729-72745751 AAACTGAACTTAATGCAAAATGG + Intronic
1055385005 9:75751928-75751950 CTACTGGTATGAATGTAAAATGG + Intergenic
1055532443 9:77198415-77198437 ATGATGTTACCAATGCAAAAAGG - Intronic
1055789602 9:79909644-79909666 ATACAGTTTTTGATGCAAAGAGG + Intergenic
1059571256 9:115438738-115438760 ACACTGATTTTAATGGAAAAAGG - Intergenic
1059620236 9:115996717-115996739 ATACAGTTATAAATGGAAAGTGG + Intergenic
1187266766 X:17740973-17740995 ACATTGTTATTAATCCAAATAGG + Intronic
1187714411 X:22088411-22088433 TTACTGGTAAGAATGCAAAATGG - Intronic
1188368725 X:29342454-29342476 ATTCTGTTTTTACTGCTAAATGG - Intronic
1191961631 X:66709329-66709351 AAACTTTTTTTAATTCAAAAAGG + Intergenic
1192585095 X:72313093-72313115 TTCCTGTTATTTATGCATAATGG + Intergenic
1192849304 X:74937476-74937498 TTACTGTTAAGAATGTAAAATGG - Intergenic
1192882349 X:75299635-75299657 TCACTGTTATTAATACAAAAAGG - Intronic
1193094707 X:77534283-77534305 ATGCTGCTATTAATTTAAAAGGG - Intronic
1193437211 X:81489957-81489979 ATAGTGTTATTGATACAAAAAGG - Intergenic
1193680152 X:84508970-84508992 TTTCTGTTTTTAATGCAGAATGG - Intergenic
1193686653 X:84584782-84584804 TTACTGTGATTAATGAAAACAGG + Intergenic
1193987183 X:88257688-88257710 ATATTGTTTTTAATAAAAAAAGG - Intergenic
1194496044 X:94617719-94617741 AGACTGTTATAAAAGAAAAAGGG - Intergenic
1194876056 X:99188932-99188954 ATACTATAAGAAATGCAAAATGG - Intergenic
1195005091 X:100678067-100678089 ATGCTGTTAATAATGAAAGAAGG - Intronic
1195239848 X:102940141-102940163 ATTATGTTTTTATTGCAAAATGG + Intergenic
1195496041 X:105534851-105534873 ATACAGTAGTTAATTCAAAATGG + Intronic
1195633001 X:107079381-107079403 ATACTCTTATACATGCATAATGG - Intronic
1196979840 X:121200075-121200097 AGACTGGTATTAATGCACATTGG - Intergenic
1197099784 X:122638483-122638505 CTACTGTTGTAAATGAAAAATGG + Intergenic
1197805146 X:130391476-130391498 ATACTGTAATTATTACACAATGG + Intergenic
1198113272 X:133521632-133521654 ATGCTGTTATTCTTGGAAAACGG + Intergenic
1198732042 X:139742044-139742066 ATACTAATATTAATCCAAAGAGG + Intronic
1198794277 X:140379090-140379112 ATACTGCAATTAATGCATAGTGG - Intergenic
1199533371 X:148874296-148874318 TTACTGATATTAAGGCAAACTGG - Intronic
1199604102 X:149563072-149563094 AAACTGATATGAAGGCAAAAAGG + Intergenic
1199867685 X:151868151-151868173 TTACTTTTAGCAATGCAAAATGG + Intergenic
1199986692 X:152957834-152957856 AAATTTTAATTAATGCAAAAAGG - Intronic
1201848903 Y:18454934-18454956 ACACAGTTACTAATTCAAAAAGG - Intergenic
1201884415 Y:18865441-18865463 ACACAGTTACTAATTCAAAAAGG + Intergenic