ID: 1029414177

View in Genome Browser
Species Human (GRCh38)
Location 7:100432719-100432741
Sequence AGGAAGAAGCAGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3137
Summary {0: 1, 1: 0, 2: 29, 3: 295, 4: 2812}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029414171_1029414177 -1 Left 1029414171 7:100432697-100432719 CCTTTTTTGGCTTACCACCAGTA 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG 0: 1
1: 0
2: 29
3: 295
4: 2812
1029414168_1029414177 27 Left 1029414168 7:100432669-100432691 CCATTTAAAATTACTCAGGCTCC 0: 1
1: 0
2: 0
3: 42
4: 688
Right 1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG 0: 1
1: 0
2: 29
3: 295
4: 2812
1029414170_1029414177 6 Left 1029414170 7:100432690-100432712 CCGTCGACCTTTTTTGGCTTACC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG 0: 1
1: 0
2: 29
3: 295
4: 2812

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029414177 Original CRISPR AGGAAGAAGCAGAGGCAGGA AGG Intronic
Too many off-targets to display for this crispr