ID: 1029414919

View in Genome Browser
Species Human (GRCh38)
Location 7:100436472-100436494
Sequence GGTTTCCGGTAGCGGCGTCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 1, 2: 0, 3: 0, 4: 17}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029414919_1029414923 -4 Left 1029414919 7:100436472-100436494 CCTAGACGCCGCTACCGGAAACC 0: 1
1: 1
2: 0
3: 0
4: 17
Right 1029414923 7:100436491-100436513 AACCGTTAACCCTTTCCTTCGGG 0: 1
1: 0
2: 0
3: 3
4: 69
1029414919_1029414926 -2 Left 1029414919 7:100436472-100436494 CCTAGACGCCGCTACCGGAAACC 0: 1
1: 1
2: 0
3: 0
4: 17
Right 1029414926 7:100436493-100436515 CCGTTAACCCTTTCCTTCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
1029414919_1029414924 -3 Left 1029414919 7:100436472-100436494 CCTAGACGCCGCTACCGGAAACC 0: 1
1: 1
2: 0
3: 0
4: 17
Right 1029414924 7:100436492-100436514 ACCGTTAACCCTTTCCTTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1029414919_1029414927 1 Left 1029414919 7:100436472-100436494 CCTAGACGCCGCTACCGGAAACC 0: 1
1: 1
2: 0
3: 0
4: 17
Right 1029414927 7:100436496-100436518 TTAACCCTTTCCTTCGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 67
1029414919_1029414922 -5 Left 1029414919 7:100436472-100436494 CCTAGACGCCGCTACCGGAAACC 0: 1
1: 1
2: 0
3: 0
4: 17
Right 1029414922 7:100436490-100436512 AAACCGTTAACCCTTTCCTTCGG 0: 1
1: 0
2: 0
3: 4
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029414919 Original CRISPR GGTTTCCGGTAGCGGCGTCT AGG (reversed) Exonic
1077140873 11:1024334-1024356 GGTTAGCGGCAGCGGCATCTTGG - Intronic
1132749020 16:1448841-1448863 GGTTTCTGGGGGCGGCCTCTGGG - Intronic
1134567673 16:15265412-15265434 GGTTTGTGGTAGCGGGGTATTGG - Intergenic
1134734765 16:16490941-16490963 GGTTTGTGGTAGCGGGGTATTGG + Intergenic
1134932708 16:18220965-18220987 GGTTTGTGGTAGCGGGGTATTGG - Intergenic
1137709070 16:50554047-50554069 GGTCTCCGGTAGAGGCTTCGAGG + Intronic
1139403066 16:66697007-66697029 GGGTTCAGGCAGCGGGGTCTTGG + Intergenic
1146037197 17:29417771-29417793 GGTTTCCAGTGGCAGGGTCTGGG - Intronic
1154354379 18:13613812-13613834 GGTATCAGGTAGCCGCGCCTGGG + Intronic
1157324309 18:46657732-46657754 GGCTTCCGGAAGTGGCCTCTGGG + Intergenic
930498883 2:52185521-52185543 GGTTTCGGGGAGCGGTGTCATGG - Intergenic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
953210459 3:40870631-40870653 GGTTTCCAGCAGCGGCTTGTGGG - Intergenic
954112173 3:48440256-48440278 CGTTTCCGGTGGCAGGGTCTGGG + Exonic
968057713 3:195705447-195705469 GGTGTCCGGTAGTGTGGTCTGGG - Intergenic
999146873 5:149402109-149402131 GGGTTCCCGTACAGGCGTCTTGG + Intronic
1029414919 7:100436472-100436494 GGTTTCCGGTAGCGGCGTCTAGG - Exonic
1035404041 7:158587165-158587187 GGTTTAGGGGAGGGGCGTCTCGG - Intronic
1047990122 8:130277278-130277300 GGTTTCCTGTAGCAGCCACTTGG + Intronic