ID: 1029415905

View in Genome Browser
Species Human (GRCh38)
Location 7:100443114-100443136
Sequence ATGTCCACACTGGGCATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029415901_1029415905 4 Left 1029415901 7:100443087-100443109 CCTGAGCTTGCTGGGGAGATGTC No data
Right 1029415905 7:100443114-100443136 ATGTCCACACTGGGCATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029415905 Original CRISPR ATGTCCACACTGGGCATAGA AGG Intergenic