ID: 1029418864

View in Genome Browser
Species Human (GRCh38)
Location 7:100461618-100461640
Sequence GGTTGTTAGGGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 1, 2: 6, 3: 42, 4: 437}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029418864_1029418873 4 Left 1029418864 7:100461618-100461640 CCCTCCACCTTCCCCTAACAACC 0: 1
1: 1
2: 6
3: 42
4: 437
Right 1029418873 7:100461645-100461667 CAAGCCAAGCTAACACCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029418864 Original CRISPR GGTTGTTAGGGGAAGGTGGA GGG (reversed) Intronic
901636593 1:10673389-10673411 GGCTGTTAGGCGAAGGGAGAGGG - Intronic
901860293 1:12070025-12070047 GGTGGTTAGGAGAAGGTGGCAGG + Intronic
901936796 1:12632342-12632364 GGTTGCTAGGGCATGGGGGAGGG + Intergenic
902108488 1:14058149-14058171 GGATAGTGGGGGAAGGTGGAGGG - Intergenic
902435428 1:16395393-16395415 GGGGGTTAGGGGAAGGTTGGGGG + Exonic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903021212 1:20396547-20396569 GGTGGGTAGGGGAAGCTGCAGGG + Intergenic
903341487 1:22657568-22657590 GGTTGTCAGGGGCTGGGGGAAGG + Intronic
904267933 1:29328508-29328530 GGTTGTTAGGGGATTGTGCAAGG - Intergenic
904961189 1:34334359-34334381 AGTTGTCATGGGAATGTGGAAGG + Intergenic
905364666 1:37443611-37443633 AGTTGGGAGGGCAAGGTGGAAGG + Intergenic
906402690 1:45517109-45517131 GCTTGTTAGGCAAAGCTGGAAGG - Intronic
907121947 1:52015746-52015768 GGTTGCTAGGGGTTGGTGGGAGG - Intergenic
907295210 1:53447070-53447092 GATTGGTAGAGGAAAGTGGAGGG - Intergenic
907650913 1:56294035-56294057 GGTTGTCAGTGGAAGGTGGTAGG - Intergenic
908002804 1:59697356-59697378 GGTTGCTAGGGGTTGGGGGAGGG - Intronic
911684508 1:100759404-100759426 GTTTGTTATGGGAAGGAAGAAGG + Intergenic
912227825 1:107755388-107755410 GGGGGTGAGGGGAAGCTGGATGG + Intronic
912283927 1:108348058-108348080 GGGGGTTGGGGGAAAGTGGAAGG - Intergenic
912715911 1:111983448-111983470 GGTTGCTAGGGCAAGGAGTAGGG - Intronic
913720837 1:121592706-121592728 GGTTACTAGGGGATGGGGGAGGG + Intergenic
915562283 1:156694242-156694264 GGGTGGGAGGGGAAGCTGGAGGG + Intergenic
915964833 1:160297502-160297524 GGTTCTTGGGGGAAGGAGGAAGG - Intronic
916831586 1:168497768-168497790 GGTTCAGAGGGAAAGGTGGAAGG + Intergenic
917218697 1:172704556-172704578 TGGTGTTGGGGGAAGGGGGAGGG + Intergenic
917597008 1:176539301-176539323 GGTTGCCAGGGGCAGGTTGAAGG + Intronic
917856292 1:179102932-179102954 GGTTTACAGGGGGAGGTGGATGG - Exonic
918808972 1:189091505-189091527 TGGTGTTAGGGGATGGGGGAGGG - Intergenic
918961077 1:191278774-191278796 GGTTGTCAGGAGATGGAGGAGGG - Intergenic
919709297 1:200710369-200710391 GCCTGTGAGGGGAAGGGGGAGGG + Intergenic
920001612 1:202803926-202803948 GGTAGTTAGGGGTCGGGGGAGGG + Intronic
920285517 1:204875925-204875947 GGTTGGTGGGGAAAAGTGGAAGG + Intronic
920649136 1:207823752-207823774 GGTTGTGGGGCGACGGTGGAGGG - Intergenic
921060522 1:211580162-211580184 GGTTGCTATGGGGAGGTGGAGGG + Intergenic
921222463 1:212982800-212982822 GGTACTTAGTGGAAGGTGGCAGG + Intronic
921271169 1:213471517-213471539 GGAAGGTAGGAGAAGGTGGAGGG - Intergenic
921450353 1:215298122-215298144 GGTAGTAAATGGAAGGTGGATGG - Intergenic
922547478 1:226469166-226469188 GGTTGTCAGGGGCCGGAGGAAGG - Intergenic
923959335 1:239059059-239059081 GGTTGTGAGGTCAAGCTGGAGGG + Intergenic
1065204486 10:23344163-23344185 GGTGGGGAGGGGAAGGGGGAAGG + Intronic
1065614854 10:27510001-27510023 GGTGGTGAGAGGAAGGTAGAAGG - Intronic
1065696828 10:28388114-28388136 GGAAGGGAGGGGAAGGTGGAAGG + Intergenic
1066934935 10:41817586-41817608 TGGGGTTAGGGGAAGGGGGAGGG - Intergenic
1067826506 10:49577808-49577830 GGTTGCTAGGGGTTGGTGGCAGG - Intergenic
1070186478 10:74067813-74067835 GGTTATCAGGGGACGGGGGAAGG + Intronic
1071786273 10:88903692-88903714 TGTGGTTAGGGAAAAGTGGATGG + Intronic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074880748 10:117655764-117655786 TGTTATTAGGGGCAGGAGGAAGG + Intergenic
1074960995 10:118445819-118445841 GGATGATAGGGGAGGGTGGATGG - Intergenic
1075323514 10:121511437-121511459 GGGTGGTGGGGGAAGGTGTAGGG - Intronic
1075869697 10:125762032-125762054 GGTTGTTGGGGGAAGGCAGGAGG + Intronic
1075956003 10:126523739-126523761 GGTTGTTAGGGGCTGGGGGAAGG - Intronic
1076845116 10:133066027-133066049 GGTGGATGGGGGAGGGTGGATGG + Intergenic
1076845193 10:133066261-133066283 GGTGGATGGGGGAGGGTGGATGG + Intergenic
1076845248 10:133066431-133066453 GGTGGATGGGGGAGGGTGGATGG + Intergenic
1076845292 10:133066571-133066593 GGTGGATGGGGGAGGGTGGATGG + Intergenic
1077129644 11:964489-964511 GGGTGTTAGGGGAATCTGGTTGG + Intronic
1077714208 11:4565333-4565355 GGTTGATAGGTGCAGGTTGATGG + Intergenic
1078370195 11:10737904-10737926 GGCTGTTATGTGGAGGTGGAGGG - Intergenic
1078835276 11:15022281-15022303 GCCTGTTAGGGGGAGGTGAAGGG + Intronic
1079222241 11:18573381-18573403 GGGTATTAGGGAAAGGAGGAAGG - Intronic
1079485851 11:20935357-20935379 GGCTGCCAGTGGAAGGTGGATGG + Intronic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1080073161 11:28114142-28114164 GGTTGTCAGGGGCTGGGGGAAGG - Intronic
1080250491 11:30228316-30228338 GGTGGGTAGAGGAAGGTGGTAGG - Intergenic
1080323139 11:31038069-31038091 TGTTGTTGGGGGAGGGGGGAGGG + Intronic
1081296183 11:41392536-41392558 GTTTGTTTGGGGGAGGTGGTGGG - Intronic
1081385147 11:42463327-42463349 GGGAGGGAGGGGAAGGTGGAAGG + Intergenic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1081655645 11:44855751-44855773 AGATGTCAGGGGAAGGTGGGTGG - Intronic
1081781386 11:45715524-45715546 GTTTGCTGGGGGAAGGTGGGAGG - Intergenic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082920919 11:58492914-58492936 GGTTGTTAGGGGCAGGGGGAGGG + Intergenic
1083527973 11:63389323-63389345 GGGGGTTGGGGGAAGGGGGAGGG - Intronic
1083938917 11:65884753-65884775 GGTTGATGGAGGGAGGTGGATGG - Intronic
1084322567 11:68381800-68381822 GGTTGGGAGGGGCAGGTGCAGGG - Intronic
1084939292 11:72603779-72603801 AGTTGTTAGGGGAAGGTGAAAGG + Intronic
1086472794 11:87133700-87133722 GGTTGTTTGGGAAAGTGGGAGGG - Intronic
1087745020 11:101933977-101933999 GGATGTGAGAGGGAGGTGGAAGG + Intronic
1087857462 11:103109535-103109557 GGAAGTTGGGGGAAGGGGGAAGG - Intronic
1088426400 11:109709482-109709504 GGAGGTTAGTGGAAGGGGGAGGG + Intergenic
1089078362 11:115757073-115757095 GGCTGTGATGGGAATGTGGATGG + Intergenic
1089297319 11:117477987-117478009 GGATGGGTGGGGAAGGTGGAGGG - Intronic
1089618440 11:119708598-119708620 GGTTGTCAGGGGCCGGGGGAGGG + Intronic
1090384003 11:126346001-126346023 GGATGGCAGGGGAAGGAGGAGGG - Intergenic
1090414113 11:126529015-126529037 GGTTGTCAGGTGGACGTGGAGGG + Intronic
1090436449 11:126690509-126690531 GGTTCTTTGGGGAAGGATGACGG + Intronic
1091413205 12:257784-257806 GGCTGACAGGGGAAAGTGGAGGG - Intronic
1091440897 12:511347-511369 GGTTGAAGGTGGAAGGTGGAAGG - Intronic
1091441286 12:512953-512975 GGTGGAAAGTGGAAGGTGGAAGG - Intronic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1094360904 12:29629648-29629670 GGTTATCAGGGGATGGAGGAGGG + Intronic
1095460407 12:42437844-42437866 AGTTGCCAGGGGAAAGTGGAAGG - Intronic
1095482800 12:42653172-42653194 TGTGGTGGGGGGAAGGTGGAGGG - Intergenic
1096793045 12:54056992-54057014 GTTTGTTAGGAGAAGGTGGGAGG + Intergenic
1096891011 12:54771149-54771171 GGATGGTAGGAGAAGGGGGATGG - Intergenic
1097019068 12:56007448-56007470 AGTTGTTAGGGGGAGGGGGACGG + Intergenic
1099509400 12:83515339-83515361 AGTTATTAGGGGAATGTAGAAGG - Intergenic
1099935433 12:89119356-89119378 GTTTGTTGGGGGACGGGGGAAGG - Intergenic
1101111741 12:101493002-101493024 GATTGCTAGGGGCAGGGGGAAGG - Intergenic
1102524203 12:113499690-113499712 GGTTGCAAGGCGAAGCTGGAGGG + Intergenic
1102575619 12:113854459-113854481 GGTTGATGGGGGAAGGAGAATGG - Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103364830 12:120374301-120374323 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1103499226 12:121388038-121388060 GGTTGTGAGGTGAGGGTGGTGGG + Intronic
1103698350 12:122835084-122835106 GGAGGGTAGGGGAAGGGGGAGGG - Intronic
1103958450 12:124592763-124592785 GGTTGTTAGCACAAGGTGGGTGG - Intergenic
1104012738 12:124943441-124943463 GCTGCTTCGGGGAAGGTGGAAGG + Intergenic
1104441167 12:128794589-128794611 GGCTGCTAGGGGCAGGTGGGGGG - Intronic
1104478056 12:129086383-129086405 GGAGGTTAGGGGGAGGTTGAGGG - Intronic
1105248852 13:18677785-18677807 GGTTGTCAGGGGGAGGAAGAAGG - Intergenic
1105282254 13:18973289-18973311 GGTTGTCAGGGGCTGGGGGAAGG + Intergenic
1105356973 13:19667527-19667549 GGTTGTCAGGGGCTGGGGGAGGG - Intronic
1106253842 13:28004001-28004023 GCCTGTTAGGGATAGGTGGAGGG + Exonic
1107300867 13:38964344-38964366 GGGTGGTGGGGGAAGTTGGAAGG - Intergenic
1107672674 13:42762068-42762090 GGTTGTTAGTGGAAAATTGAAGG + Intergenic
1107842614 13:44474737-44474759 GGGAGGTAGGGGAAGGAGGACGG + Intronic
1108097964 13:46924401-46924423 GGTTTTTTGGGGGAGGTGGGTGG - Intergenic
1110994582 13:82090599-82090621 GGTGGGGAGGGGAAGGTGGAGGG - Intergenic
1111393931 13:87637871-87637893 GATTCTTAGGGGAAGCTAGAAGG + Intergenic
1111406547 13:87813937-87813959 GGTGGTAAGGTGTAGGTGGAAGG - Intergenic
1111838119 13:93414258-93414280 AGCTGTTAGGGGAGGGTGAATGG - Intronic
1111885425 13:94014699-94014721 GGTTGTCAGGGGATGGGGCAAGG - Intronic
1113243577 13:108368169-108368191 GCTTGATAGGAGAAGGTGGGAGG + Intergenic
1114747310 14:25163582-25163604 GGAGGTTAGGGGGAGGTGAAGGG - Intergenic
1115695227 14:35890623-35890645 GGTAGGTGGGGGAAGGAGGAGGG - Intronic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1117294159 14:54363867-54363889 TGTTGTTAGGGGCAGATAGAAGG + Intergenic
1117312692 14:54543973-54543995 GGTTGTCAGGGGCTGGGGGAGGG - Intergenic
1118012023 14:61619182-61619204 GGTTGCCAGGGGATGGGGGAAGG + Intronic
1119233716 14:73002251-73002273 GGTTGCTAGAGGAAGGAGGGAGG + Intronic
1119682963 14:76606668-76606690 GGTTGCTAGGGGAAGGGAGATGG - Intergenic
1119683464 14:76611110-76611132 GGTGGTTAGCAGAAGCTGGAGGG + Intergenic
1120141951 14:80939519-80939541 GGTGGTTTGGGGAAAGTGTAGGG - Exonic
1120580594 14:86243290-86243312 GGTTGCTAGGGGTCAGTGGAGGG + Intergenic
1120676722 14:87429140-87429162 TGTTGTGGGGGGAAGGGGGAGGG + Intergenic
1121005009 14:90484511-90484533 GGTAGGAATGGGAAGGTGGATGG - Intergenic
1121991017 14:98557296-98557318 GGTTGCTTGGTGAAGGTGAATGG + Intergenic
1122793575 14:104194703-104194725 GGTGCTTAGGGGAACCTGGAAGG + Intergenic
1122878617 14:104680005-104680027 GGATGGTAGGGCCAGGTGGAGGG - Intergenic
1123012815 14:105357496-105357518 GGCTGCCAGTGGAAGGTGGAAGG - Intronic
1202943619 14_KI270726v1_random:6655-6677 GGGGGTTGGGGGAAGGGGGAGGG - Intergenic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128170297 15:65505393-65505415 GGTTGTGAGGGGAAGTTAGTAGG + Intronic
1128520968 15:68374682-68374704 GGATGCTAGGGGAAGGAAGAAGG + Intronic
1128783357 15:70377414-70377436 GGTTGGAGGAGGAAGGTGGAGGG - Intergenic
1131310781 15:91288019-91288041 AGTTGGGAGGGGAAGGTGGCTGG - Intronic
1132891903 16:2208751-2208773 GGTTGTCCGAGGAAGCTGGAGGG - Exonic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1135193583 16:20375926-20375948 GGTTTTTAGGGGAAGCTCCAAGG - Intronic
1135244101 16:20839577-20839599 GGTTCTTTGGGGAAGGTGTGTGG + Intronic
1135275082 16:21105233-21105255 GGATGTCAGGGGGAGGTTGATGG - Intronic
1135431967 16:22392299-22392321 GGAGGTTAGGGAAGGGTGGAAGG - Intronic
1135632772 16:24049134-24049156 GGTTGTGAGAAGCAGGTGGATGG + Intronic
1136619807 16:31420899-31420921 AGTTGTTAGGGGAAGGAGCGAGG + Intronic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137737283 16:50734384-50734406 GGTGCTTAGGTGAGGGTGGAGGG + Intergenic
1139206874 16:65037602-65037624 GGTTGTTAGGGGAGAGAGGAGGG - Intronic
1139645614 16:68327529-68327551 GGTTGTTGGGGGAATGGGGGAGG + Intronic
1140393072 16:74605174-74605196 GGGGGTTGGGGGGAGGTGGAGGG - Intronic
1141949009 16:87328816-87328838 GCTTGATTGGGGAAGGTGGCAGG - Exonic
1142332838 16:89466328-89466350 AGTTGTCAGGGAAAGGGGGAAGG + Intronic
1142353120 16:89588814-89588836 GGGGGTGAGGGGAAGGTGGTGGG - Intronic
1143253898 17:5541822-5541844 GGTGGGCAGGGGGAGGTGGAGGG - Intronic
1143564625 17:7714171-7714193 GGTTTTTAGGGAAAGGGGAATGG + Intergenic
1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG + Intronic
1143897773 17:10149934-10149956 GGTTGTTAGGGGTAAGGAGATGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144088886 17:11835575-11835597 GGTTGAGAGGCAAAGGTGGAAGG + Intronic
1144090724 17:11853963-11853985 GGTGGTTAGGGGAACATGAATGG - Intronic
1144245112 17:13355390-13355412 GGTTGTTGGTAGATGGTGGATGG + Intergenic
1144585865 17:16487300-16487322 TGTTCTTAGGTGGAGGTGGAAGG + Intronic
1145712939 17:26993270-26993292 TGTGGTTGGGGGAAGGTGGTGGG - Intergenic
1145739361 17:27259696-27259718 GGATGGGAGGGGAAGGAGGAAGG - Intergenic
1146688329 17:34856616-34856638 GGGGGTTAGGGGAGGGTAGAGGG + Intergenic
1146978387 17:37136222-37136244 GGTTGTTAGGGGTGGAGGGAGGG - Intronic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147923382 17:43932408-43932430 GGTGGTGAGGGGCAGGTGAAGGG - Intergenic
1148243485 17:46014965-46014987 GGTAGTGAGGGGATGGTGGGGGG + Intronic
1148388197 17:47251748-47251770 GCAGGTTTGGGGAAGGTGGAGGG - Intergenic
1148737829 17:49874670-49874692 GGTTGTTAGGTGGGCGTGGAGGG - Intergenic
1148842038 17:50505163-50505185 GATTGTTAGGGGATGGGGGTCGG + Intergenic
1150284100 17:63945800-63945822 GGTGGTAAGGGGGAGGGGGAGGG + Intronic
1150335042 17:64324854-64324876 GGTTGCTAGGGGTTGCTGGAGGG + Intronic
1150370730 17:64635508-64635530 GGTTGCTAGGGGATGGGGGAGGG - Intronic
1151081684 17:71336516-71336538 GGGTGTGAGGGGAAAGGGGATGG + Intergenic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1151539991 17:74759930-74759952 GGTTGTTATGGGAAGGTTTTTGG + Intronic
1152082222 17:78195130-78195152 GGTTGGTAGGGGCAAGGGGAGGG + Intronic
1152098214 17:78285241-78285263 GGTTGTCAGGGGCTGGGGGAGGG + Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153004936 18:489804-489826 GGTTGTTAGGGGAAGGTAAAAGG + Intronic
1154440026 18:14381451-14381473 GGTTGTGAGGGGGAGGAAGAAGG + Intergenic
1155103004 18:22632316-22632338 ATTTGCTAGGGAAAGGTGGAAGG - Intergenic
1155518530 18:26646264-26646286 AGTTGTTAGGGGGAGCAGGAGGG + Intronic
1156005760 18:32438989-32439011 GGTGGTAAGGTGCAGGTGGAGGG + Intronic
1157482447 18:48064205-48064227 GGTTGGAATGGCAAGGTGGATGG - Intronic
1157703771 18:49783278-49783300 GGTTGTCAGGGGATGGGGGATGG + Exonic
1158274097 18:55747930-55747952 GGTTGGTGGGGGGAAGTGGATGG + Intergenic
1159134558 18:64321895-64321917 GGTAGTAAGGTGAAGGGGGAAGG + Intergenic
1159492746 18:69159567-69159589 TGTTTTTAGGGGAAGGAGGAGGG - Intergenic
1159632903 18:70769312-70769334 GGCTTTTGGGGGAGGGTGGATGG + Intergenic
1160409831 18:78667932-78667954 GGTGGATGGGGGAGGGTGGATGG - Intergenic
1160589127 18:79931626-79931648 TGTGGTTGGGTGAAGGTGGAGGG - Intronic
1160788923 19:913764-913786 GGCTGGGAGGGGCAGGTGGAAGG - Intergenic
1161113460 19:2483144-2483166 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1161403783 19:4080890-4080912 GGTGGGGAGGGGAAGGGGGAGGG + Intergenic
1162978049 19:14220095-14220117 GGTTGCCAGGGGATGGGGGATGG + Intergenic
1163043915 19:14624913-14624935 GCCTGTTAGGGGACGTTGGAGGG + Intronic
1163250336 19:16122973-16122995 GGTGGTCAGGGCAGGGTGGAAGG - Intronic
1163369868 19:16896104-16896126 GGTTGGTAGGGGAGGGAGGTGGG + Intronic
1163667592 19:18610575-18610597 GGTTGTTGGGGGAGGACGGAGGG - Intronic
1163675418 19:18653394-18653416 GGTGGATAGGGGCAGGTGGGTGG - Intronic
1163821181 19:19497502-19497524 GGCTCTGAGGGGAAGGAGGAGGG + Intronic
1165069542 19:33247663-33247685 GGCTGTTAGGGGCAGGGAGAGGG + Intergenic
1165149888 19:33754031-33754053 GGTTGTTGGGGGATGGTGGGGGG - Intronic
1165176513 19:33934381-33934403 GGTGGCCAAGGGAAGGTGGAGGG + Intergenic
1165475218 19:36026492-36026514 GGCTGCGAGGGGAAGGAGGACGG - Intronic
1165959236 19:39520518-39520540 GGTTGTGAGGGAAACGGGGATGG + Exonic
1166231603 19:41428107-41428129 GGTTGAGAGAGGCAGGTGGAGGG + Intronic
1166234013 19:41442826-41442848 GGTGGTGGGGGGCAGGTGGAAGG + Intergenic
1166567983 19:43776691-43776713 GGTTTTGAAGGAAAGGTGGAGGG - Intronic
1166997086 19:46724772-46724794 GGATGTGAGGGGAAGGCGGGAGG + Intronic
925276336 2:2650939-2650961 GGTTGTTTGGGGAAAGATGAGGG + Intergenic
925938789 2:8794605-8794627 GGTTGATAGGGAAAAGTGAAAGG - Intronic
926917840 2:17909861-17909883 TGAAGTTAGGGGAGGGTGGATGG + Intronic
926980834 2:18566257-18566279 GGTTTCTAGGGGAAGGTCAAGGG + Intronic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
928616241 2:33042516-33042538 GGTTGCCAGTGGAAGCTGGAAGG + Intronic
928983468 2:37158242-37158264 GGTTGTTGGGGGATGGAGAAGGG - Intergenic
929622013 2:43364769-43364791 GGTTATTAGAGGAAGGTCCATGG + Intronic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
931161116 2:59691600-59691622 GGTTAAAAGGGGATGGTGGAAGG + Intergenic
931732462 2:65165390-65165412 GGTAGTTGGGGGAAGGTGGATGG + Intergenic
932883216 2:75523607-75523629 GGTTGGGAGGGGAAGGTTGATGG - Intronic
933177977 2:79197303-79197325 AGTGGTAAGGGGAAGCTGGAGGG + Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
933837317 2:86256464-86256486 GGATGATTGGGGCAGGTGGATGG - Intronic
935008989 2:99113367-99113389 GGGGGAGAGGGGAAGGTGGAGGG + Intronic
935224230 2:101039049-101039071 GGTTGCTAGGGGCTGGGGGAAGG + Intronic
936889891 2:117356965-117356987 GGTTGCCAGGGGATGGGGGAGGG - Intergenic
937921576 2:127135288-127135310 GGATGGAACGGGAAGGTGGAGGG + Intergenic
938238645 2:129725822-129725844 GGTAGAGAGGGGAAGGTGGTGGG - Intergenic
939741418 2:145912006-145912028 GGTGGTTAGTGGGAGGTGCAGGG - Intergenic
940901493 2:159130370-159130392 AGTTGTGAGGGGAAGGTGCTGGG + Intronic
941270549 2:163422006-163422028 TATTGTTAAGGGAAGGTTGAGGG + Intergenic
941624790 2:167819701-167819723 AATTGTTAGTGGAAGGTGGCGGG + Intergenic
941886265 2:170530818-170530840 GGTGGTGTGGTGAAGGTGGAAGG + Intronic
942269645 2:174261499-174261521 GGTTGCTAGGGTTAGGGGGAAGG + Intergenic
942460765 2:176166855-176166877 GGCTGTTTGGTGCAGGTGGAGGG + Intronic
943367254 2:186977863-186977885 GGTTGGGAGGGGAAGCTGGAGGG + Intergenic
944489311 2:200241817-200241839 CATTGCTAGGGGAAGGTGCAGGG - Intergenic
944945178 2:204676130-204676152 GGTAATGAGGGGAAGGTGGGAGG + Intronic
946834955 2:223763509-223763531 GGGAGTTGGGGGCAGGTGGAGGG - Intronic
947080344 2:226388933-226388955 GGGTTTTAGAGGAAGGTGGAAGG + Intergenic
949027489 2:241773418-241773440 GAGGGTTAGGGGCAGGTGGAGGG + Intergenic
1168976389 20:1969268-1969290 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1169855588 20:10098822-10098844 GGCTGGTAAGGGAAGGGGGAAGG + Intergenic
1170006711 20:11677525-11677547 TGTTGTTAGGGAGATGTGGAAGG - Intergenic
1170564142 20:17585754-17585776 GGTTGTTGGGGATAGGAGGAGGG - Intronic
1170973851 20:21141918-21141940 GGATGGCAGGAGAAGGTGGAGGG - Intronic
1171406371 20:24914841-24914863 GGATGGGAGGGGAAGGTGCAGGG - Intergenic
1173605536 20:44328372-44328394 GGTTTCTAGAGGAAGCTGGAGGG - Intergenic
1173861900 20:46289240-46289262 GGTTGTAAGGGAAAGGTGCATGG - Intronic
1173986703 20:47267220-47267242 GGTTGTTAGGGGCAGGCTGTGGG + Intronic
1175320519 20:58084669-58084691 GGGTGGGAGGGGAAGGAGGAAGG - Intergenic
1175742764 20:61431803-61431825 GGTTGCCAGGGGATGGGGGAGGG - Intronic
1176455720 21:6908320-6908342 GGTTGTGAGGGGGAGGAAGAAGG - Intergenic
1176658160 21:9607056-9607078 GGTTGCTAGGGGCTGGGGGAAGG + Intergenic
1176833893 21:13773368-13773390 GGTTGTGAGGGGGAGGAAGAAGG - Intergenic
1179589813 21:42399427-42399449 GGTTCTCAGGGGAGGGTGTAGGG + Intergenic
1179604470 21:42504919-42504941 GATTGGTTGGGGAAGGGGGAAGG - Intronic
1181804057 22:25364577-25364599 GGTTGGGAGGGGCAGGTGCAGGG + Intronic
1182020999 22:27081433-27081455 GGATGTTAGAGGGAGATGGATGG - Intergenic
1183306678 22:37086489-37086511 GGCTGCTGGGGGAGGGTGGACGG + Intronic
1183761179 22:39819571-39819593 GGTTGTTAGGGGTTAGTGGGAGG + Intronic
1184030155 22:41888964-41888986 AGTTGTTGGGGGCAAGTGGAGGG + Intronic
1184254765 22:43280643-43280665 GGCTGATAGGGGAAGTTGGTAGG - Intronic
1184729856 22:46366171-46366193 GGTTGTTGGGGGAAGGTGCAGGG + Intronic
1185224371 22:49644466-49644488 GGTGGATAGTGGATGGTGGATGG + Intronic
1185336808 22:50274654-50274676 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1185336868 22:50274780-50274802 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1185341355 22:50292719-50292741 GGTTGCCACGGGCAGGTGGAGGG - Intronic
949565964 3:5245126-5245148 GGATGTTAGGGGACAGGGGAAGG + Intergenic
950053211 3:10007583-10007605 GGGTGTCAGGGGAGGGTTGATGG + Intronic
951927941 3:27930251-27930273 GGTTGTTAGGGGTAGGAGAAGGG + Intergenic
952037606 3:29221422-29221444 GGGTGTTGGGGGAAAGGGGAGGG - Intergenic
952797745 3:37257082-37257104 GGTTGCTAGGGGTTGGAGGAAGG - Intronic
954411764 3:50374121-50374143 GGAGGTAAGGGGAAGGAGGAAGG + Intronic
955113269 3:55971431-55971453 GGTTTATTGGGGAAGATGGAGGG - Intronic
955207993 3:56914825-56914847 GGTTGCCAGGGGATGGGGGAGGG + Intronic
955338192 3:58104300-58104322 GGTGGTTAGGGGCTGGTGGGAGG + Intronic
955453576 3:59096653-59096675 GGTTGTTGGGGGGAAGGGGAGGG - Intergenic
955677998 3:61469563-61469585 GGTTGCTAGGGGATGGGGAAGGG - Intergenic
955864968 3:63372530-63372552 GGTTGTGGGGGAAAGGGGGATGG - Intronic
956325655 3:68049775-68049797 GGTGGTGAGGGGAAGGAGCAGGG + Intronic
957941555 3:87011832-87011854 GGTTGGTAGGAGATGGTGGTTGG - Intergenic
958129183 3:89395803-89395825 GGATGGGAGGGGAAGGTGGAAGG - Intronic
960091692 3:113646470-113646492 AGTTGCTGGGGGAAGGTGGAAGG - Intergenic
960153647 3:114275840-114275862 GGCTGTTGGGGGATGGTGAAGGG + Intergenic
960403895 3:117236432-117236454 GGGTGTTGGGAGAGGGTGGAAGG - Intergenic
961037780 3:123654661-123654683 GGGGGTTAGGAGAAGGTGGAGGG - Intronic
961145960 3:124593579-124593601 GCAGGTTAGGGGAGGGTGGAGGG - Intronic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
962158224 3:132971619-132971641 GGTTGCTAGGGGATGGGGGAGGG + Intergenic
962647493 3:137454897-137454919 GGTTGTTTGGGGGAGAGGGAAGG - Intergenic
962668756 3:137683792-137683814 GGTTGCTAGGGGCTGGGGGAAGG + Intergenic
963579075 3:147101140-147101162 GGTTGTTGGGGGAATGTGTTGGG - Intergenic
963824975 3:149943687-149943709 GGTTGCTAGGGGATGGGGGAAGG - Intronic
964376328 3:156052133-156052155 GGTTGTGGGGGGCAGGGGGAGGG - Intronic
967834470 3:193949339-193949361 GGTAGTTAGGGGAAGAAGCATGG + Intergenic
967900039 3:194440505-194440527 GCTTGTTGGGGGATGGGGGATGG - Intronic
968741019 4:2331820-2331842 GATTGGCAGGGGGAGGTGGAAGG - Intronic
968994545 4:3937373-3937395 TGTGGTTGGGGGATGGTGGATGG + Intergenic
969430586 4:7151543-7151565 GGTTATGAGGGGCAGGTGGAGGG + Intergenic
969495787 4:7525498-7525520 GCTGCTTGGGGGAAGGTGGAGGG - Intronic
969575639 4:8034561-8034583 GGTAGGTAGGGGCAGGTGGGTGG + Intronic
969631568 4:8341682-8341704 GGTGGTGAGGGGGACGTGGAGGG + Intergenic
972559496 4:40214278-40214300 GGTGGTTAGAGAAAGGTAGATGG + Intronic
973009582 4:45054578-45054600 GGTTGTTGGGGGAAGATTGCAGG + Intergenic
975758215 4:77592409-77592431 GGTTGTCAGGGGTTGGGGGAAGG + Intronic
976385701 4:84455475-84455497 GTTTGTGATGGGAAGGTGTAAGG - Intergenic
976786768 4:88830165-88830187 GGGTGTTAGAGGAAAGAGGAAGG + Intronic
977159999 4:93622096-93622118 GGTTGTTAGAGGAAGCTTCAAGG + Intronic
977890832 4:102309405-102309427 GGCTGTTAGGTGAAGTTGTAGGG - Intronic
979168332 4:117565358-117565380 GGTTGTGAGGGGCCAGTGGAAGG - Intergenic
981139694 4:141254089-141254111 TGTTCCTAGGGGAAGGGGGATGG - Intergenic
981642225 4:146957718-146957740 GGCTTTTAGGGGAAGGAGTAAGG + Intergenic
981691645 4:147515363-147515385 GGTGGTGGGGGGAAGGGGGATGG + Intronic
981956327 4:150478321-150478343 GGTTGTGTGGAGGAGGTGGAGGG - Intronic
981974908 4:150714849-150714871 GCTTGTTAGGTGAATGTGGATGG - Intronic
981975379 4:150722100-150722122 TGTTCTGAGGGGAGGGTGGAAGG - Intronic
983520992 4:168708939-168708961 GTTTGTTGTGGAAAGGTGGAGGG + Intronic
983966357 4:173817085-173817107 GGTTGTTAGGTGCTGGGGGAAGG + Intergenic
984164201 4:176288174-176288196 GGAAGGTAGGGGAAGGGGGAAGG - Intergenic
985059027 4:186057974-186057996 GGTGGATAGCGGGAGGTGGATGG - Intergenic
986021794 5:3811589-3811611 GGTTGTCAGGGGTTGGGGGAAGG + Intergenic
986064757 5:4224177-4224199 GGTAGTTGGGGCAGGGTGGAGGG + Intergenic
987189224 5:15456948-15456970 AGTGGTTAGGGGGAGGGGGAGGG - Intergenic
987792143 5:22581555-22581577 GCTTGCTAGGGCAATGTGGAAGG + Intronic
988631522 5:32936641-32936663 GGTTTTAATGGGAAGGTGTAAGG + Intergenic
989306727 5:39966432-39966454 GGTTGTGAGAGAAAGGTGAAGGG - Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
989751261 5:44896506-44896528 GGTTGCCAGGGGATGGGGGAAGG - Intergenic
990539366 5:56757114-56757136 GGCTGTGAGGGGAAGGAAGAGGG - Intergenic
991379200 5:66001955-66001977 GGGAGTGAGGGGAAAGTGGAGGG - Intronic
991410549 5:66341421-66341443 GGTTGCTAGGTGAAGGTTGCTGG - Intergenic
991687578 5:69195839-69195861 GGGTATGAGGGGAAAGTGGAGGG + Intronic
992486667 5:77203694-77203716 GGATATTAGGGGGAGTTGGAAGG - Intergenic
992639329 5:78755247-78755269 TGGTGTTGGGGGAAGGTGGGAGG - Intronic
992863771 5:80937898-80937920 GCTTGATGGGGGAATGTGGATGG + Intergenic
993705861 5:91169434-91169456 GGTTGCCAGGGGATGGGGGAGGG + Intergenic
994947934 5:106420550-106420572 GGTTGGTAGGGGTAGGTGTTGGG - Intergenic
997334431 5:133095856-133095878 GGCTGTCAGGGGATGGGGGAGGG - Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998535866 5:142930229-142930251 GGTCTTTAGAGAAAGGTGGAAGG + Intronic
999217627 5:149948574-149948596 GGTGGTAAGGGACAGGTGGAGGG - Intergenic
1000251194 5:159497348-159497370 GGAGGGTAGGGGAAAGTGGAGGG + Intergenic
1000268189 5:159657979-159658001 GGCTGGGAGGGGAAGGTGGGTGG + Intergenic
1000443217 5:161287095-161287117 TGTAGTCAGGGGAAGGTGGGAGG - Intergenic
1001519973 5:172384518-172384540 GGTTGCTGGGGGAGGGTGGAAGG - Intronic
1002399722 5:178984866-178984888 GGTTCTCAGGGCCAGGTGGAGGG - Intronic
1003092682 6:3117670-3117692 GGTTGTTGAGGGCTGGTGGAAGG - Intergenic
1003094767 6:3133537-3133559 GGTTGGGAGGGGAAAGTGGGGGG - Intronic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1005192294 6:23238673-23238695 GTTTGTTGGGTGAAGGTGGATGG + Intergenic
1005965926 6:30726434-30726456 GGTTGTTGGGGGTAGGGGGGTGG + Intergenic
1009750675 6:67875250-67875272 GCCTGTCAGAGGAAGGTGGAGGG + Intergenic
1010211011 6:73363025-73363047 TCTTGGGAGGGGAAGGTGGAAGG - Intronic
1010494251 6:76514004-76514026 GGTTCTTATGGGCAGGAGGATGG + Intergenic
1010503880 6:76632564-76632586 GGCTGCTAGGGGATGGGGGAAGG + Intergenic
1011464247 6:87639400-87639422 AGTTGTTGGGGGAAGGTAGGAGG - Intronic
1011632351 6:89339573-89339595 GGTGGGGAGGGGAAGGGGGAAGG + Intronic
1013149740 6:107432930-107432952 GGGTGGTAGGGAAAGGTAGAGGG - Intronic
1013306754 6:108854900-108854922 GGTTGCTAGGGGATGAGGGAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015212748 6:130716802-130716824 GGTTAATAGGGGAATGGGGAAGG + Intergenic
1015231872 6:130923984-130924006 GGTTGCTAGGGGCTGGGGGAGGG - Intronic
1015545494 6:134357159-134357181 GGTAGTTGGGGGAAGGAGTATGG - Intergenic
1015887655 6:137935165-137935187 GGTTGCCAGGGGATGGTGGAAGG - Intergenic
1016067070 6:139695198-139695220 GGGTGTTACGGGAAAGTGAAAGG - Intergenic
1016851602 6:148624823-148624845 GGGTGCCAGGGGCAGGTGGAGGG + Intergenic
1017141589 6:151195786-151195808 GGTTGTCAGGGGTTGGAGGATGG + Intergenic
1017229832 6:152062189-152062211 AATTGTTAGGGGAAGCGGGAAGG - Intronic
1018822430 6:167383617-167383639 GGGTGTGAGGGGAATGTGAATGG + Intronic
1019575764 7:1736985-1737007 GGTAGCTGGGGGCAGGTGGAAGG - Intronic
1019892011 7:3954526-3954548 GGTTGTAAAGGGGAGGTGGGAGG - Intronic
1020347411 7:7181209-7181231 GGATGTTGCGGAAAGGTGGAAGG + Intronic
1020804379 7:12770327-12770349 GGTTGGTAGGGTAAGGAGGGTGG + Intergenic
1021157214 7:17225409-17225431 GGTTGTCAGGGGATGGTTGGGGG - Intergenic
1021171569 7:17404044-17404066 GGTTATTAGGGGAAGGGGCTGGG - Intergenic
1021330415 7:19331574-19331596 GGTTGTTAGGGGCTAGTGGGAGG - Intergenic
1022420797 7:30221448-30221470 GGTTGTCAGGGCCTGGTGGAGGG + Intergenic
1022491941 7:30827470-30827492 GGTGGTTAGAGGGATGTGGAAGG - Intronic
1022762126 7:33366052-33366074 GGGGGTTAGGGGAATGTGCAAGG + Intronic
1023067254 7:36390094-36390116 GGTTGACAGAGGAAGGTGGGTGG - Exonic
1023217419 7:37878794-37878816 TGTTGATAGGAGAAGGTGGGAGG - Intronic
1023250114 7:38249968-38249990 GGATGGCAGGGGAAAGTGGAAGG + Intergenic
1023251419 7:38266074-38266096 GGATGGCAGGGGAAAGTGGAAGG + Intergenic
1025184595 7:56847652-56847674 GGTGGGAAGGGGGAGGTGGAGGG - Intergenic
1025638354 7:63344413-63344435 GGTTGCTAGGGGGTGGTGGCTGG + Intergenic
1025644342 7:63403676-63403698 GGTTGCTAGGGGGTGGTGGCTGG - Intergenic
1025687334 7:63729316-63729338 GGTGGGAAGGGGGAGGTGGAGGG + Intergenic
1026120869 7:67536145-67536167 GGGTGTTAGGGGAAAGCGGAGGG - Intergenic
1026873373 7:73866598-73866620 GGTTGTTGGGTGATGATGGATGG - Intergenic
1028216641 7:88140948-88140970 GGGTTTTATGGGGAGGTGGAGGG + Intronic
1028486841 7:91368431-91368453 GGTTGCTAGGGGCTGGAGGAGGG - Intergenic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1029457007 7:100676394-100676416 TGTTGGTGGGGGAAGGGGGAGGG + Intronic
1029567729 7:101350085-101350107 GGAAGGTAGAGGAAGGTGGAAGG - Intergenic
1029880799 7:103807608-103807630 GCTTGAGAGGGGAGGGTGGAAGG - Intronic
1031430718 7:121665407-121665429 GGTTGGAAGGGAAAGATGGAAGG - Intergenic
1031906499 7:127465806-127465828 GGTTTTCAGGGGATGGTGGCTGG - Intergenic
1032182460 7:129692080-129692102 GGGTGGCAGGGGAATGTGGAGGG - Intronic
1033153557 7:138937185-138937207 GATAGTTACGGGAAGGAGGAGGG - Intronic
1034056646 7:148042350-148042372 GGTTGCCAGGGCATGGTGGAGGG + Intronic
1035000486 7:155608879-155608901 TGTTGTGAGGGAAAGGTGGAGGG + Intergenic
1035796517 8:2362356-2362378 TGTTGTTGTGGGAAGGTTGAGGG - Intergenic
1036151798 8:6305891-6305913 GGTTGTCAGGGGCTGGGGGATGG - Intergenic
1036595266 8:10206357-10206379 GGTTCTGAGGGCAAGGTGGTGGG - Intronic
1037152583 8:15655844-15655866 GGTGGTTTGGGGAAGAAGGAAGG - Intronic
1037675034 8:21044014-21044036 GGGTGGTGGTGGAAGGTGGAGGG - Intergenic
1037748215 8:21663016-21663038 GCTTGGTAGGGGAGGGTGGGGGG - Intergenic
1038406648 8:27326944-27326966 GGCTGCCAGGGGAAGGTGCAGGG + Intronic
1038750693 8:30292733-30292755 GGTTGTGGGGGAAAGGTAGAGGG - Intergenic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1040856183 8:51950406-51950428 GGTTGCCAGGGGATGGGGGAAGG + Intergenic
1040886646 8:52270711-52270733 GGTTGTTTGGGGGTGGTGCAGGG + Intronic
1041010312 8:53535857-53535879 GGTTGTTTTGGGAAGGAGGGTGG - Intergenic
1041090398 8:54296621-54296643 GGATGGTAGGGGATGGTGGGTGG + Intergenic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041392895 8:57362864-57362886 GGTTGTCATGGTAAGGTGGTAGG + Intergenic
1043639017 8:82425667-82425689 GGTTGTCAGGGGTTGGGGGAAGG - Intergenic
1043739688 8:83795149-83795171 GGTTGTCAGGGGTTGGGGGAGGG + Intergenic
1045020464 8:98039001-98039023 GGTTGGTATGGGATGGTGGCAGG - Intronic
1047196173 8:122723579-122723601 GGGGATTAGGGGAAGGTGGAAGG - Intergenic
1049359557 8:142205810-142205832 GGATGTGAGGGGAAGGGGGAAGG + Intergenic
1050200028 9:3134940-3134962 GGTTGTTAGGGGTTAGGGGAAGG + Intergenic
1050387952 9:5110825-5110847 GTTTGTTCGGGGAAGGTGGGGGG + Intronic
1051657545 9:19397325-19397347 GGGGGTTGGGGGAAGGTGGGAGG + Intergenic
1052816427 9:33105632-33105654 GGTTGTCAGGGGCATGGGGAAGG - Intronic
1052947344 9:34179023-34179045 GGCGGTGAGGGGAAGGAGGAGGG + Exonic
1053588384 9:39484505-39484527 GGTTGTTGGGAGAAGGGGCATGG - Intergenic
1054577923 9:66880789-66880811 GGTTGTTGGGAGAAGGGGCATGG + Intronic
1054808311 9:69413328-69413350 GGGAGCTTGGGGAAGGTGGATGG - Intergenic
1055478861 9:76690208-76690230 GGTAGTTGGGGGAAGGAAGAAGG - Intronic
1055960814 9:81818454-81818476 GGTTGTAGGGGGCAGGTGGATGG + Intergenic
1056588653 9:87946624-87946646 GGTTGCTAGGGGATAGGGGAGGG - Intergenic
1056714781 9:89020292-89020314 GGGTGAGAGGTGAAGGTGGAGGG + Intronic
1056837525 9:89968966-89968988 TGTGGTTAGGGGCAGGTGGAGGG + Intergenic
1056870473 9:90272788-90272810 GGATGTGAGAGGAAAGTGGAGGG + Intergenic
1057293854 9:93824250-93824272 GGTTGGGGGGAGAAGGTGGAGGG + Intergenic
1058179272 9:101777655-101777677 CATTGTTGGGGGAAGGTGGTGGG - Intergenic
1059424156 9:114210454-114210476 GGCTGTCTGGGGAAGGTGGTGGG + Intronic
1059652358 9:116326742-116326764 GGTTGCTAGGGGATGGGGAAGGG - Intronic
1059990675 9:119862330-119862352 GGTTTTTAGGGGCAGGAGGCTGG - Intergenic
1061704822 9:132444931-132444953 TGTTGCTAGGGGCTGGTGGAGGG - Intronic
1062440170 9:136566224-136566246 GGAGGTTCGGGGAATGTGGAGGG - Intergenic
1062561041 9:137142033-137142055 GGTCGTTGGGGGTAGGTGGATGG - Exonic
1186055232 X:5643012-5643034 GGTTGCCAGGGGAAAGGGGAAGG + Intergenic
1186461128 X:9749445-9749467 GGTTGCTAGGGGCTGGGGGATGG - Intronic
1186463895 X:9769496-9769518 GGTGGCTAGGGGCAGATGGATGG + Intronic
1186484249 X:9921622-9921644 GGTTGTTAGGGGATGGGGGAAGG - Intronic
1186520397 X:10201176-10201198 AGTGGTGAGGGGAAGGAGGAAGG + Intronic
1187396334 X:18922686-18922708 GGTTGCTAGGGGCGGGAGGAGGG + Intronic
1187821210 X:23290391-23290413 GGTTATTGGGTGGAGGTGGAGGG - Intergenic
1188243352 X:27814193-27814215 GGGTGTGAGGGGCAGGGGGAGGG - Intronic
1190102740 X:47534748-47534770 GGTTGTTAGGGGCTGGAGGGAGG + Intergenic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1190801882 X:53796710-53796732 TGAAGTAAGGGGAAGGTGGAGGG - Intergenic
1192263814 X:69525069-69525091 GGTAGGTTGGGGAAGGGGGAGGG - Intronic
1192531318 X:71889159-71889181 TGGTGTTGGGGGAGGGTGGAGGG + Intergenic
1193235845 X:79106306-79106328 GGGGGTTAGGGGTAAGTGGAGGG + Intergenic
1195780305 X:108455101-108455123 GGTTATTTGGGGATGGAGGATGG - Intronic
1196637270 X:118017047-118017069 GATTATTTGGGGAAGGAGGACGG - Intronic
1197994717 X:132360995-132361017 GGTTGTCATGGGTAGGTGCAGGG - Intergenic
1198007701 X:132515492-132515514 GGTTGCCAGGGGTAGGAGGAGGG + Intergenic
1198489063 X:137120085-137120107 AGTTGCTGGGGGATGGTGGAGGG + Intergenic
1199239780 X:145532892-145532914 TGTTGCTAGGGGATGGTGTACGG - Intergenic
1199808859 X:151329161-151329183 GGGTGTCAGGGGCTGGTGGAGGG + Intergenic
1200213349 X:154356644-154356666 GGGGGATAGGGGAAGGGGGAAGG + Intronic
1200916203 Y:8573382-8573404 GGGTGTCAGTGGAAGATGGATGG - Intergenic
1200963859 Y:9018945-9018967 GGGTGTCAGAGGAAGGTGGCTGG + Intergenic
1201642967 Y:16198916-16198938 TGTTGTTATGGGGAGGTGTATGG + Intergenic
1201659848 Y:16386405-16386427 TGTTGTTATGGGGAGGTGTATGG - Intergenic