ID: 1029420201

View in Genome Browser
Species Human (GRCh38)
Location 7:100468135-100468157
Sequence ATTGGCTCCTTGGGGACACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029420186_1029420201 7 Left 1029420186 7:100468105-100468127 CCACCCCCCCAAGGGCAAGGCCT 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG No data
1029420193_1029420201 -1 Left 1029420193 7:100468113-100468135 CCAAGGGCAAGGCCTGGCTGCTA No data
Right 1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG No data
1029420182_1029420201 22 Left 1029420182 7:100468090-100468112 CCTGAAAGATATACACCACCCCC No data
Right 1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG No data
1029420192_1029420201 0 Left 1029420192 7:100468112-100468134 CCCAAGGGCAAGGCCTGGCTGCT No data
Right 1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG No data
1029420190_1029420201 2 Left 1029420190 7:100468110-100468132 CCCCCAAGGGCAAGGCCTGGCTG 0: 1
1: 1
2: 3
3: 35
4: 360
Right 1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG No data
1029420189_1029420201 3 Left 1029420189 7:100468109-100468131 CCCCCCAAGGGCAAGGCCTGGCT 0: 1
1: 0
2: 6
3: 20
4: 297
Right 1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG No data
1029420191_1029420201 1 Left 1029420191 7:100468111-100468133 CCCCAAGGGCAAGGCCTGGCTGC 0: 1
1: 1
2: 3
3: 46
4: 332
Right 1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG No data
1029420188_1029420201 4 Left 1029420188 7:100468108-100468130 CCCCCCCAAGGGCAAGGCCTGGC No data
Right 1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029420201 Original CRISPR ATTGGCTCCTTGGGGACACG GGG Intronic