ID: 1029424597

View in Genome Browser
Species Human (GRCh38)
Location 7:100488054-100488076
Sequence ATGTCCTTGCAGAAGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029424587_1029424597 26 Left 1029424587 7:100488005-100488027 CCTCCTGGGGCTGTAAGTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1029424597 7:100488054-100488076 ATGTCCTTGCAGAAGGGTCAAGG 0: 1
1: 0
2: 2
3: 18
4: 176
1029424589_1029424597 23 Left 1029424589 7:100488008-100488030 CCTGGGGCTGTAAGTTGAGGAAT 0: 1
1: 0
2: 5
3: 18
4: 151
Right 1029424597 7:100488054-100488076 ATGTCCTTGCAGAAGGGTCAAGG 0: 1
1: 0
2: 2
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029424597 Original CRISPR ATGTCCTTGCAGAAGGGTCA AGG Intronic
901248187 1:7750227-7750249 AGGTTCTTGCAGAAGGGTCCTGG + Intronic
901743722 1:11358970-11358992 TTCTCCTTGCAGATGGGTCAGGG + Intergenic
904579468 1:31530516-31530538 ATTTCCTTGCAGAAGAGTCATGG - Intergenic
905347160 1:37318994-37319016 GTGTGCTTGCATAAGGGTCTAGG + Intergenic
906304542 1:44708509-44708531 ATGTCTTGGAAGAAGGGTCAGGG + Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907380210 1:54080931-54080953 ATGACCTTGGGGAAAGGTCATGG + Intronic
907674645 1:56507273-56507295 ATGTCTGTGCACAAAGGTCATGG + Intronic
907848318 1:58229661-58229683 ACGTACTTGCAGAGGGGTCATGG + Intronic
908022830 1:59915954-59915976 ATGTTCTCGCATAGGGGTCACGG + Exonic
908794043 1:67813541-67813563 ATGTACTTTCAGTGGGGTCAAGG - Intronic
909030068 1:70529020-70529042 AAGTTCCTGAAGAAGGGTCATGG - Intergenic
910732381 1:90412180-90412202 ACCTCCTTTCAGAAGAGTCATGG + Intergenic
914398177 1:147290538-147290560 ATGACCTTGCACAAGGGCCCTGG - Intronic
915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG + Intronic
916492160 1:165311533-165311555 ATGTCCATGCAGTAGCTTCAGGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
921112358 1:212051191-212051213 AAGTACTTGCAGAAAGGTTAAGG - Intronic
922007742 1:221549250-221549272 ATGTGGATGGAGAAGGGTCAGGG + Intergenic
922462239 1:225822817-225822839 ATGTCCTTGGTGAAGGCACATGG + Intronic
923598374 1:235378926-235378948 TTGTGCTTGCAAAAGGGGCACGG + Intronic
1065778960 10:29149007-29149029 AAGGCCTTGCAGAAGAGTAAGGG - Intergenic
1067137981 10:43628735-43628757 ATGTCGTTGCCATAGGGTCAGGG - Intergenic
1068530045 10:58175548-58175570 GTGTCCTCGCATAAGGGTGAGGG - Intergenic
1069772764 10:70910037-70910059 ATGTTCTTGCTGATGGGTGAGGG + Intergenic
1076893871 10:133299317-133299339 ATGTCCTTCCAGCAGGGGCCCGG + Intronic
1077023539 11:430171-430193 ATCTCCTTGCTGAAGGGGCAGGG + Exonic
1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG + Intergenic
1078169568 11:8919240-8919262 CTGTCCTTGCAGAGGTGTGATGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079343058 11:19628938-19628960 AGGTGCTTGCAGCAAGGTCAGGG - Intronic
1079732105 11:23946330-23946352 ATTTCCTTGCACAAGGGCCTGGG + Intergenic
1080871988 11:36244457-36244479 GTGTCCTTGTAGGAGGGACATGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083019261 11:59489680-59489702 ATGTCTTTGCATTAGGGTAAAGG - Intergenic
1083067108 11:59936177-59936199 ATGTCTTTTCAGAAGAGTCTTGG - Intergenic
1084348365 11:68573917-68573939 ATGACCATGCAGCATGGTCAGGG - Intronic
1085176098 11:74489422-74489444 ATTTCCCTGGAGAAGGCTCATGG + Intergenic
1085394573 11:76200843-76200865 ATGGCCTAGCAGCAGGCTCATGG + Intronic
1085528816 11:77179723-77179745 CTGTCCTTGCAGATGCGTCTGGG + Exonic
1086534092 11:87822420-87822442 ATGTCTTTGCAGATGGTTCTTGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088059292 11:105626798-105626820 ATTTTCTTACAGAAGGGGCAGGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093405703 12:18801544-18801566 ATTTCCTTTCAGTAGGGACAGGG + Intergenic
1093999942 12:25684139-25684161 ATGTCCTTGGAGATGGTCCATGG + Intergenic
1095965035 12:47861413-47861435 GTTGCCTTGCAGAAGGCTCATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102022384 12:109692837-109692859 CTGTCCTAGCAGAAAGGTGAAGG - Intergenic
1104724609 12:131068043-131068065 ATCTCCCTCCAGAAGGATCAGGG - Intronic
1105290678 13:19051099-19051121 ACGATCTTGCAGATGGGTCATGG + Intergenic
1110029233 13:70585216-70585238 ATGTCTGTGCAGGAGGGTCATGG + Intergenic
1111073467 13:83200448-83200470 ATGTCCTCCAAGAAGGATCAGGG + Intergenic
1112521419 13:100098664-100098686 ATGGCCTGGCGGAAGAGTCAAGG + Intronic
1112565404 13:100547739-100547761 ATCTCTTGGCAGCAGGGTCAAGG + Intronic
1113950488 13:114068828-114068850 ACTTCCTTGGAGAAGGGCCAAGG + Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1117130540 14:52682371-52682393 ATGTCATTCCAGAAAGGACACGG + Exonic
1117430183 14:55650179-55650201 ATGTCTTTGTAGAATGGCCAGGG - Intronic
1117896934 14:60496830-60496852 ATCACCTTGGAGAAGGGCCAGGG - Intronic
1117997494 14:61491605-61491627 ATATCCTTGAAGAAGGATCTTGG - Intronic
1118287941 14:64494170-64494192 ATGACCTTGCAGAAAGGAGATGG + Intronic
1121501452 14:94441643-94441665 ACCTCCTTGGAGTAGGGTCAGGG + Intergenic
1125070318 15:35546326-35546348 ATGTCCCTGCCACAGGGTCAAGG - Intergenic
1126076201 15:44912595-44912617 ATGTCATGGGAGAAGGGCCAGGG + Intergenic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1129727123 15:77906970-77906992 ATGTCCTTGAAAGAGGGCCATGG - Intergenic
1129917248 15:79284435-79284457 CTTTCCTTGCAAAAGTGTCAGGG + Intergenic
1130275438 15:82473749-82473771 ATGTTCTTGAAAGAGGGTCACGG - Intergenic
1130467798 15:84201144-84201166 ATGTTCTTGAAAGAGGGTCACGG - Intergenic
1130485885 15:84398324-84398346 ATGTTCTTGGAAGAGGGTCACGG + Intergenic
1130496467 15:84472398-84472420 ATGTTCTTGAAAGAGGGTCACGG + Intergenic
1130590090 15:85205742-85205764 ATGTTCTTGAAAGAGGGTCACGG - Intergenic
1134348006 16:13409369-13409391 CTGTCCTTGCAGAAAGGTGGAGG + Intergenic
1135748341 16:25036487-25036509 ATATCCCTGGGGAAGGGTCAGGG - Intergenic
1137538307 16:49344199-49344221 AAGTCCTTGCTGAAGGTCCAGGG + Intergenic
1137676234 16:50305128-50305150 GTGGCCATGCAGAAGGGCCAGGG - Intronic
1137836109 16:51594137-51594159 TTGTCTTTGCAGAGGGATCATGG + Intergenic
1138414306 16:56862584-56862606 GTGTCCCTGGAGGAGGGTCAGGG - Intergenic
1139199088 16:64954512-64954534 CTGTGCTTCCAGAAGGCTCAGGG + Intronic
1144878237 17:18414138-18414160 GTGTCCTTTCAGGAAGGTCATGG + Intergenic
1145228294 17:21150162-21150184 AAGTCCTTGGAAAAGGGGCAAGG + Intronic
1151149416 17:72071435-72071457 ATGGCCTTCCAGATGTGTCAGGG + Intergenic
1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG + Intronic
1151837170 17:76589537-76589559 AGGACCTTGCAGAGGGGGCAGGG - Intergenic
1153585477 18:6616026-6616048 ATTTCCTAGCTGAAGGATCAGGG + Intergenic
1154005219 18:10521579-10521601 ATTACCTTGAAGAAGGGCCATGG + Intergenic
1156459321 18:37312845-37312867 ATGTCCTTGGCCAAGGGTCCTGG - Intronic
1156648413 18:39195692-39195714 GTGTACTTGCAGAATGGCCAGGG - Intergenic
1158253788 18:55521614-55521636 ATGGCCTTGCAGAAGGCACATGG - Intronic
1158281394 18:55832195-55832217 GTGGCCTTGCACAAGGGACAGGG + Intergenic
1158723005 18:59942570-59942592 ATGTCCTTGCTGAAGGCGCTTGG - Intergenic
1159101529 18:63964057-63964079 ATGTCCTTGCTGGAGGGTGTGGG - Intronic
1163117715 19:15198245-15198267 CTGTCCTGCCAGAAGGGTCCAGG + Intronic
1166093560 19:40525790-40525812 AAGTCCAGGCAGAAAGGTCAGGG + Intronic
1166137485 19:40786281-40786303 AGGCCCAGGCAGAAGGGTCAGGG + Intronic
1166339887 19:42131103-42131125 AGGCCCAGGCAGAAGGGTCAGGG - Intronic
1166376975 19:42333198-42333220 ATGTCCAGGCTGGAGGGTCAAGG - Intronic
925121875 2:1425027-1425049 ATGACTTTACAGAAGGGGCACGG - Intronic
925121901 2:1425416-1425438 ATGACTTTACAGAAGGGGCACGG - Intronic
925400744 2:3570488-3570510 GTGTCCTTGCAGAAGGGCTGAGG - Intergenic
925671260 2:6311972-6311994 ATGTCCTTGCAGAAAGCCCCTGG + Intergenic
927518975 2:23687988-23688010 ATGGCCATGCAGAAGGGTCCCGG + Intronic
930245898 2:48983067-48983089 ATGGCCTTGAAGAATAGTCAGGG + Intronic
933093216 2:78146409-78146431 GTGATCTTGCAGAAGGGTTAGGG + Intergenic
933736246 2:85497068-85497090 ATGCCCATTCAGAAGGGTGAAGG - Intergenic
934880005 2:97968516-97968538 ATCTCCCTGCAGTAGGGTCTCGG + Intronic
935160933 2:100528826-100528848 GTGTCCTTCCAGGAGTGTCAAGG - Intergenic
936031711 2:109077304-109077326 ATCTCCTTGAAGAAGATTCAAGG + Intergenic
937861536 2:126715170-126715192 GTGTCCTTGAAGAAGGGAAATGG - Intergenic
941852288 2:170195833-170195855 ATGTCCTATGAGAGGGGTCAGGG + Intronic
946404686 2:219486104-219486126 TTTTCTGTGCAGAAGGGTCAGGG - Intronic
947323669 2:228951010-228951032 AAGTCACTGCAGAAGGGACAAGG - Intronic
1169233778 20:3912127-3912149 ATGTACTTGGAGAAGGGAAAGGG + Intronic
1171507334 20:25648305-25648327 AAGTCCTTGCATAGGGGTGATGG - Intergenic
1174588094 20:51624268-51624290 CTGTCCTTTCAGCAGGGCCATGG - Intronic
1175139126 20:56846823-56846845 TTGGCCTTGGAGAAGGGCCATGG - Intergenic
1177594088 21:23212965-23212987 ATGTGCTTGCAAAAGCTTCATGG - Intergenic
1177838427 21:26210949-26210971 GTGTCATTGCTGTAGGGTCATGG + Intergenic
1179523232 21:41958927-41958949 ATCTCCTTTCATAAAGGTCAAGG + Intergenic
1181318838 22:21989269-21989291 ATGTCTTTCCAGCAGTGTCAGGG - Intergenic
1181395559 22:22618718-22618740 ATGACCTTGCTGCAGGGTGAGGG + Intergenic
1182576302 22:31275375-31275397 CTGTGCTTGCAGAGGGCTCAGGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1185241631 22:49750287-49750309 ATGTCCCAGCAGAGGGGTCAGGG - Intergenic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
957985034 3:87562813-87562835 ATGTCCTTCCACAGGGGTTAGGG + Intergenic
958033886 3:88148444-88148466 AGCTCCTTGAAGAAAGGTCAGGG + Intronic
963036392 3:141033443-141033465 ATGACCTTCCAGAGGGGTCTTGG - Intergenic
963041678 3:141074890-141074912 AGGCCCTGGCAGAAGGGTGAAGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966542139 3:181103733-181103755 TTGTCTTTGAAGAAGAGTCAAGG + Intergenic
966835919 3:184049439-184049461 AGGTCACTGCGGAAGGGTCAGGG - Intergenic
969886061 4:10216627-10216649 ATGTGCCTGTAGAAGGGTCAGGG - Intergenic
969919978 4:10529190-10529212 TTTTCATTGCAGAAGGTTCATGG - Intronic
971962857 4:33511345-33511367 ATGCCCATCCAGAAGGGTAAAGG - Intergenic
972361447 4:38329161-38329183 ATTTCCTTGCAGAAGGGTGGTGG - Intergenic
973713504 4:53652352-53652374 AAAGCCTTGCAGAAGGGGCAGGG - Intronic
977254777 4:94728302-94728324 ATTTCCTGGCAGAAGTTTCAAGG + Intergenic
978176441 4:105737742-105737764 ATGTTTTTACAGAAGTGTCAAGG - Intronic
979382060 4:120018908-120018930 ATGGCCTTTCAAAAGGGACAAGG - Intergenic
982158993 4:152548503-152548525 ATGGCCTGGCACAAGGGTCAGGG - Intergenic
983279534 4:165662682-165662704 AAGTACTTGCAGAAGGCTCAGGG + Intergenic
985010472 4:185577396-185577418 ATTTCTTTGCTGAAGGGTTAGGG + Intergenic
985834209 5:2258836-2258858 ATGTGCTTGCAGCAGGGGCCAGG - Intergenic
986605328 5:9517294-9517316 ATGTCTTTGCAGAAGGAAAAGGG + Intronic
986780236 5:11058529-11058551 ATGTCCAGGCAGAAGGGACAGGG + Intronic
987617666 5:20297442-20297464 ATTTTCTTACAGAAGGATCATGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989412308 5:41134180-41134202 ATGTCCTTGCCTATGGGACAGGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992299073 5:75359120-75359142 ATGTTCCTCCAGAAGGTTCAGGG - Intronic
992996313 5:82337406-82337428 ATGTGGTTGGAGAAGTGTCATGG + Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993584522 5:89707764-89707786 GTGTCTTTGCAGAAAGGACAGGG - Intergenic
993877678 5:93327336-93327358 ATGTCCTTGGAGAAAGGTATTGG + Intergenic
994711871 5:103275816-103275838 AGGTCCTTTTAGAAGGCTCAGGG - Intronic
996785506 5:127232682-127232704 ATGGCTTTTCAGAGGGGTCAGGG + Intergenic
997381738 5:133443436-133443458 ATGTCCTAGCAGAAGGGTCTGGG - Intronic
998005070 5:138651382-138651404 CTGTCCTTGCAGCACGGTGAAGG + Intronic
998482781 5:142476801-142476823 AAGACCATGCAGAAGGGTAAAGG + Intergenic
999513321 5:152275782-152275804 ATGTCTTTGAGGAAGGGGCAAGG - Intergenic
1003139422 6:3457627-3457649 GTGTCCGTGGAGCAGGGTCAAGG + Intergenic
1004956345 6:20731929-20731951 ATGTCCTGGCAGCAAGGTAAGGG - Intronic
1013122366 6:107152011-107152033 ATATCCCTGAAGAAGGGGCAGGG + Intergenic
1015254801 6:131166190-131166212 CTGTCCTTGCAGGATGCTCAAGG - Intronic
1015805580 6:137105137-137105159 ATGTCTGTGCAGTAAGGTCAGGG + Intergenic
1021884985 7:25129449-25129471 GTGTGCTTGCGGAAGGGACAGGG - Intergenic
1024365034 7:48510515-48510537 ATCTCCTTTGAGGAGGGTCAAGG - Intronic
1029424597 7:100488054-100488076 ATGTCCTTGCAGAAGGGTCAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029907264 7:104104364-104104386 AACTCCTGGCAGAAGGGTGAAGG - Intergenic
1030190661 7:106807273-106807295 ACTTCCTTACCGAAGGGTCAAGG + Intergenic
1031226986 7:119051830-119051852 ATGTCCTTGGTGAGGGGTTATGG - Intergenic
1033551716 7:142453387-142453409 ATGTCCATGGAGAAGAGTCCAGG - Intergenic
1033573372 7:142655834-142655856 ACGTCCTTCCAGGGGGGTCAGGG + Intergenic
1035268904 7:157708368-157708390 AGGTCCTGGCTGAAGGGTCGTGG - Intronic
1038428777 8:27483291-27483313 ATGTCCTGGCAGGTGGGGCATGG - Intergenic
1041480730 8:58317083-58317105 ATGGCCTTGCAGAGATGTCAGGG - Intergenic
1047229523 8:122984553-122984575 ATGTCCTTTCAGAAAGATGAGGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052885979 9:33648234-33648256 ACGTCCTTCCAGGGGGGTCAGGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056918385 9:90763981-90764003 TTCTCCTTGCAGAAAGGTGAAGG + Intergenic
1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG + Intronic
1058430209 9:104911728-104911750 GGGGCCTTGCAGAAGGGTCATGG + Intronic
1058895368 9:109396285-109396307 ATGTCTTTCTGGAAGGGTCAGGG + Intronic
1187844778 X:23524165-23524187 ATGTCCTTGCAGTGGGGTTTGGG - Intergenic
1196539079 X:116883610-116883632 ATGCCCTTGCAGAAGGGAAGTGG + Intergenic
1198443739 X:136690506-136690528 ATGGCCTTGCAGAGGAATCAAGG - Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199248349 X:145631944-145631966 ATTTCCTTGCAAAAGGGTTAAGG + Intergenic
1202054210 Y:20813252-20813274 ATGGGGTTGCAGGAGGGTCAGGG - Intergenic
1202368385 Y:24181986-24182008 ATGTTCTTGAAAGAGGGTCATGG + Intergenic
1202502400 Y:25488131-25488153 ATGTTCTTGAAAGAGGGTCATGG - Intergenic