ID: 1029425312

View in Genome Browser
Species Human (GRCh38)
Location 7:100490708-100490730
Sequence CCTCCATTGCGGTGGCAGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029425312_1029425320 9 Left 1029425312 7:100490708-100490730 CCCGCCTGCCACCGCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1029425320 7:100490740-100490762 CTGCACACACCTGTGCACAGCGG 0: 1
1: 0
2: 1
3: 42
4: 317
1029425312_1029425325 19 Left 1029425312 7:100490708-100490730 CCCGCCTGCCACCGCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1029425325 7:100490750-100490772 CTGTGCACAGCGGGGCTGGCTGG 0: 1
1: 0
2: 8
3: 26
4: 357
1029425312_1029425327 21 Left 1029425312 7:100490708-100490730 CCCGCCTGCCACCGCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1029425327 7:100490752-100490774 GTGCACAGCGGGGCTGGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 330
1029425312_1029425322 11 Left 1029425312 7:100490708-100490730 CCCGCCTGCCACCGCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1029425322 7:100490742-100490764 GCACACACCTGTGCACAGCGGGG 0: 1
1: 1
2: 2
3: 19
4: 177
1029425312_1029425323 15 Left 1029425312 7:100490708-100490730 CCCGCCTGCCACCGCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1029425323 7:100490746-100490768 ACACCTGTGCACAGCGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 189
1029425312_1029425326 20 Left 1029425312 7:100490708-100490730 CCCGCCTGCCACCGCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1029425326 7:100490751-100490773 TGTGCACAGCGGGGCTGGCTGGG 0: 1
1: 0
2: 2
3: 30
4: 208
1029425312_1029425328 22 Left 1029425312 7:100490708-100490730 CCCGCCTGCCACCGCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1029425328 7:100490753-100490775 TGCACAGCGGGGCTGGCTGGGGG 0: 1
1: 0
2: 1
3: 52
4: 300
1029425312_1029425321 10 Left 1029425312 7:100490708-100490730 CCCGCCTGCCACCGCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1029425321 7:100490741-100490763 TGCACACACCTGTGCACAGCGGG 0: 1
1: 0
2: 5
3: 27
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029425312 Original CRISPR CCTCCATTGCGGTGGCAGGC GGG (reversed) Exonic
900780777 1:4615855-4615877 CCTCCATTGGGGAAGCAGGGTGG + Intergenic
901653540 1:10756340-10756362 CCTCCATGGAGGTGACAGGAAGG - Intronic
902204108 1:14854725-14854747 TCCCCAGTGCGGTGGCAGACAGG - Intronic
905238267 1:36565349-36565371 CCTTCCTGGGGGTGGCAGGCAGG + Intergenic
905731170 1:40300415-40300437 CCTCCATTGCCCAGGCAGGAAGG - Intergenic
914934288 1:151964665-151964687 AATCCACTGCGTTGGCAGGCAGG - Intergenic
915305598 1:154975700-154975722 CCTCCAAGGCGGTGGCGGGGCGG - Intronic
915601116 1:156923932-156923954 ACTCCTCTGCGGGGGCAGGCAGG - Exonic
920386811 1:205575435-205575457 CCACCCCTGGGGTGGCAGGCAGG + Intronic
920555998 1:206905057-206905079 CCTCCATCATGGCGGCAGGCTGG + Exonic
922507687 1:226135972-226135994 CCTGCATTTCGGGGACAGGCGGG + Intergenic
1067101236 10:43336215-43336237 CCAACATTGCTGTGGCAGCCAGG - Intergenic
1069581877 10:69572231-69572253 CCTCCACGGGGGCGGCAGGCTGG - Exonic
1074866458 10:117546908-117546930 CCTCCTTTGAGGCCGCAGGCCGG - Intronic
1075671090 10:124264623-124264645 CCTCCAGTGCTGTAGCAGGCTGG + Intergenic
1076904325 10:133354743-133354765 CCTCACTTGCCCTGGCAGGCAGG - Intergenic
1077077916 11:709541-709563 CCTCCCCTGCAGTGGCAGCCTGG + Exonic
1077191330 11:1257021-1257043 CGTCCATGGTGGTGGGAGGCAGG - Intronic
1077249402 11:1554368-1554390 CCTCCAGTGCTGCGGGAGGCGGG - Exonic
1077463609 11:2723043-2723065 CCTCCATTCCCGTGCCAGGGTGG + Intronic
1081117342 11:39220094-39220116 GCTTCACTGAGGTGGCAGGCAGG - Intergenic
1081813468 11:45926124-45926146 CAGCCAGTGAGGTGGCAGGCAGG - Exonic
1082026676 11:47577838-47577860 TCACCATTTCGGTGGAAGGCCGG - Exonic
1083510790 11:63208219-63208241 GCTCCATTGCACTGCCAGGCAGG - Intronic
1083588505 11:63877948-63877970 CCTCCATTGATCTGGCAAGCTGG + Intronic
1084606969 11:70177997-70178019 GCTGCAAAGCGGTGGCAGGCAGG - Intronic
1084940760 11:72611727-72611749 CCTCCATTCCTGGGGCATGCTGG - Intronic
1090400820 11:126447258-126447280 CCTCCATCCCAGTGGCGGGCAGG + Intronic
1090426191 11:126608495-126608517 CCTCCAGTGCGTTCCCAGGCAGG + Intronic
1092147506 12:6224640-6224662 CCTCCAGTGTGGTAGCCGGCTGG - Intronic
1092629636 12:10363967-10363989 GTTCCATTGCGCTGCCAGGCAGG - Intergenic
1094327552 12:29256750-29256772 CCTTCATTGCCGGGGCTGGCAGG - Intronic
1094682586 12:32679315-32679337 CATTCATTGCCGTGGCCGGCGGG + Exonic
1102108126 12:110343313-110343335 ACCCCAGTGCAGTGGCAGGCAGG - Exonic
1103322836 12:120101837-120101859 CCTCCATTCCGTGGGGAGGCGGG - Intronic
1109586425 13:64410871-64410893 CCTCCATAGCTCTGGCATGCTGG - Intergenic
1118601185 14:67472442-67472464 CCTCCAATGCACAGGCAGGCTGG - Exonic
1119600350 14:75971809-75971831 CCTCTAGGGAGGTGGCAGGCGGG - Intronic
1120829534 14:88985905-88985927 CCTCCATGGCGGTAAGAGGCAGG + Intergenic
1121088582 14:91165475-91165497 CTTCCATTGCGGAGGAAGGCTGG + Intronic
1121889125 14:97572798-97572820 ACTCCATTGAGATGTCAGGCTGG - Intergenic
1122790928 14:104183897-104183919 ACTCCATGGCAGGGGCAGGCTGG - Intergenic
1124010876 15:25837736-25837758 CCTGCTTTGCGCTGGCTGGCAGG + Intronic
1128316251 15:66661341-66661363 CCTCCAGTGCCGTGGCTGCCTGG + Intronic
1133042663 16:3068785-3068807 CCTCCATGGCAGTGACAGGATGG - Intronic
1133308502 16:4827112-4827134 CCTTGATGGCGGAGGCAGGCAGG - Intronic
1137617400 16:49855941-49855963 CCTCCCTTGGGGGGGCAGCCCGG + Intronic
1138389727 16:56661648-56661670 CCTGCAGTGGGGTGGCTGGCAGG - Intronic
1138391723 16:56675456-56675478 CCTGCAGTGGGGTGGCCGGCAGG + Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1141669795 16:85485774-85485796 CCTCCCTAGGGATGGCAGGCAGG + Intergenic
1141722384 16:85763594-85763616 CCTCCTGTGGGGTGCCAGGCCGG + Intergenic
1142514217 17:416429-416451 CTTCCATGGCGGTGAGAGGCAGG + Intronic
1147307374 17:39573482-39573504 CCTCCATTGCGGTCGCCGCCAGG - Intergenic
1148739724 17:49885932-49885954 CCTCTAATGCTGAGGCAGGCAGG + Intergenic
1149597864 17:57874765-57874787 CCTCCAGTGAGGGGGCGGGCGGG - Intronic
1151968554 17:77445130-77445152 CCACCCTTGGGTTGGCAGGCTGG - Intronic
1153626206 18:7024437-7024459 CCATCATTGAGGTGGCAGGTGGG + Exonic
1154173419 18:12067145-12067167 CCTCCAGGGCGGTGTCAGGCGGG - Intergenic
1158897980 18:61933307-61933329 CCTCCATTGAGGTATGAGGCTGG + Intergenic
1159593941 18:70364468-70364490 CCTCCATAGCATGGGCAGGCAGG + Intergenic
1160865078 19:1252787-1252809 CCTACATCGCGGGGGCAGGGCGG + Intronic
1161736315 19:5994363-5994385 CCTCCCCAGCGGTGGCAGGTAGG + Exonic
1165932622 19:39369851-39369873 CCTCCAGTGTGGTGGCTGGGTGG - Exonic
1166740146 19:45109648-45109670 CCTCCATAGCTGTGGTGGGCTGG - Intronic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
926821916 2:16861217-16861239 CATCAATTTCAGTGGCAGGCAGG - Intergenic
932490376 2:72116250-72116272 GCTCCTTGGCAGTGGCAGGCTGG - Intergenic
932595480 2:73090798-73090820 CCACCATTACGGTAGCATGCAGG - Intronic
935602812 2:104940004-104940026 CATCCATTTGGGAGGCAGGCTGG + Intergenic
936399761 2:112156254-112156276 AGTCCATTGGGGTGGCCGGCGGG + Intronic
939718661 2:145617882-145617904 CCTCCAATGCAGTGCCAGTCAGG - Intergenic
940211345 2:151259102-151259124 CCTCTATTGCCCAGGCAGGCTGG - Intronic
941708764 2:168689009-168689031 CATCCCTTGCAGTGACAGGCAGG - Intronic
945273849 2:207968545-207968567 CCTCCATAGCCTTGGGAGGCTGG + Intronic
946180673 2:217947162-217947184 CCTGCATTGGGGTGGGAGGGAGG - Intronic
948666352 2:239536973-239536995 GCTCCATTGTGGAGGCCGGCAGG - Intergenic
1169892319 20:10466522-10466544 CTTCCCTAGCGGTGGCAGCCTGG + Intronic
1171321586 20:24248984-24249006 CCTCCCTTGGTGGGGCAGGCTGG - Intergenic
1172792168 20:37513343-37513365 CCTCCAAGGAGGGGGCAGGCAGG - Intronic
1178698514 21:34814763-34814785 CCTGCAGTCCAGTGGCAGGCAGG - Intronic
1179449414 21:41458352-41458374 CCTCCATGGTGGTGGCAGAGAGG - Intronic
1183190227 22:36317699-36317721 CCTCCACTCCAGGGGCAGGCAGG + Intronic
1184403989 22:44289651-44289673 CCACCCTGGAGGTGGCAGGCGGG + Intronic
951582354 3:24179200-24179222 CCTCCAAGGGGGTGGCAGGAAGG + Intronic
952311896 3:32198233-32198255 CCTCCCTTGGGATGGCAGGCTGG + Intergenic
952816921 3:37453647-37453669 CGTCCTTAGGGGTGGCAGGCAGG + Intronic
953758336 3:45666602-45666624 CCTCCATTGTGGGTGCAGGAGGG - Intronic
966184551 3:177216182-177216204 CCTCCAATGCCTTGCCAGGCAGG + Intergenic
967099039 3:186200883-186200905 CCTCTGTTGCTGTGCCAGGCGGG + Intronic
967201984 3:187079827-187079849 CCTCCATTTCCTTGGGAGGCAGG - Intergenic
972379871 4:38509814-38509836 CCTCCATGGTGGTGCCAGGTTGG - Intergenic
972415263 4:38832999-38833021 CTGCCATGGCAGTGGCAGGCAGG - Intronic
976692404 4:87882800-87882822 CCTCTATGGAGGTGGGAGGCCGG + Intergenic
982761062 4:159284460-159284482 TCTCCATGGCGGTGGGAGGTAGG - Intronic
987740355 5:21900238-21900260 CCTCAATTCCTGTGGAAGGCAGG + Intronic
988081261 5:26417323-26417345 CCTCCACTGAGTTGGCAGGATGG - Intergenic
997522230 5:134530413-134530435 CCTGCTGTGTGGTGGCAGGCAGG + Intronic
997735491 5:136209737-136209759 CTTCATTTGCGGAGGCAGGCAGG - Intergenic
999428166 5:151505151-151505173 GCTCCATTTTGGAGGCAGGCAGG - Exonic
1001192528 5:169643969-169643991 CTTCCCTGGCGGTGGCAGTCAGG + Intronic
1001598608 5:172914605-172914627 CATCCATTGCAGGGGCAGGCCGG - Intronic
1005678745 6:28183497-28183519 CCTCCATTGGGGTGGCATTTGGG - Intergenic
1015460227 6:133482414-133482436 CCTACATGGCAGTGACAGGCAGG - Intronic
1016393679 6:143600122-143600144 CCTCCAATGATGTGGCTGGCAGG - Intronic
1029425312 7:100490708-100490730 CCTCCATTGCGGTGGCAGGCGGG - Exonic
1034015327 7:147577580-147577602 CTTCTATTGGGGTGGCAGGAGGG + Intronic
1035655948 8:1305025-1305047 CCACCATTGCAGTGGCTGGCAGG + Intergenic
1039958232 8:42223501-42223523 CCTCCCTTGCCATGGCAGGCAGG + Intergenic
1042286226 8:67113910-67113932 CCTCAAATGTGGTGGCAGGTGGG + Intronic
1047899466 8:129404216-129404238 TCTCCATGGTGGTGGCAGGCTGG + Intergenic
1049290127 8:141797444-141797466 CCTCCACTGGGGGGGCAGGGAGG - Intergenic
1049800499 8:144515449-144515471 CCTCACTTGCTGGGGCAGGCAGG + Exonic
1050674958 9:8041769-8041791 CCTGCCTTGAGGTGGCAGGCTGG - Intergenic
1051746962 9:20304188-20304210 TCTCCACTTCAGTGGCAGGCAGG + Intergenic
1053210296 9:36222022-36222044 CCTCCAGGGAGGTGACAGGCAGG - Intronic
1059224561 9:112659838-112659860 CCTCCATTTGGGTGGGCGGCCGG - Exonic
1061547830 9:131315046-131315068 GCCCCCTTGAGGTGGCAGGCAGG + Intergenic
1186189851 X:7057583-7057605 CCGCCATTTTGGTGGCAGGAAGG + Intronic
1188791709 X:34413902-34413924 CCTCCATGGCAGTGGCAGAGGGG - Intergenic
1189282524 X:39828813-39828835 CCTCCCTTGCTGTACCAGGCAGG - Intergenic
1190098658 X:47503464-47503486 CCTGAATTGATGTGGCAGGCTGG + Intergenic
1190315288 X:49146597-49146619 CCTCTATTGCTGTGGCTAGCAGG + Intergenic
1191858153 X:65644218-65644240 CATCCTTTGTGGTGGTAGGCTGG + Intronic
1192622876 X:72697063-72697085 CCTCCATGTCGATGGAAGGCAGG + Intronic
1195245607 X:102992543-102992565 GCTCCATCTCAGTGGCAGGCCGG - Intergenic
1200011407 X:153123460-153123482 CCTCCGTTACTGTGGGAGGCAGG + Intergenic
1200028193 X:153276462-153276484 CCTCCGTTACTGTGGGAGGCAGG - Intergenic