ID: 1029426247

View in Genome Browser
Species Human (GRCh38)
Location 7:100495799-100495821
Sequence TCTATGGAACAGTAGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029426242_1029426247 5 Left 1029426242 7:100495771-100495793 CCCAAGGTCACGGTCATGGTTTT No data
Right 1029426247 7:100495799-100495821 TCTATGGAACAGTAGGAGATGGG No data
1029426243_1029426247 4 Left 1029426243 7:100495772-100495794 CCAAGGTCACGGTCATGGTTTTG No data
Right 1029426247 7:100495799-100495821 TCTATGGAACAGTAGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029426247 Original CRISPR TCTATGGAACAGTAGGAGAT GGG Intergenic
No off target data available for this crispr