ID: 1029433340

View in Genome Browser
Species Human (GRCh38)
Location 7:100546710-100546732
Sequence CCTGACATTCTGAAGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029433331_1029433340 24 Left 1029433331 7:100546663-100546685 CCTTTGAGATCACAGGGACAATG 0: 1
1: 0
2: 1
3: 19
4: 381
Right 1029433340 7:100546710-100546732 CCTGACATTCTGAAGGGGAAGGG 0: 1
1: 0
2: 1
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029433340 Original CRISPR CCTGACATTCTGAAGGGGAA GGG Intronic
900210894 1:1455446-1455468 GCTGACCTGCTGGAGGGGAAGGG - Exonic
902641832 1:17771767-17771789 CCTGACATGCTGCAGTGGAGGGG + Intronic
902764718 1:18606678-18606700 CCTGTCATTCTGGAGGGAGAGGG + Intergenic
903582486 1:24382148-24382170 CCTGACTATCTGGAGGAGAAGGG - Intronic
903811698 1:26038329-26038351 CCTGACATGGTGGAGGGAAAGGG - Exonic
906896552 1:49779474-49779496 CCTGCCTTTCTGTAGAGGAAAGG + Intronic
909677600 1:78255353-78255375 ACAGACATTCTGAAGGAGACGGG + Intergenic
915174241 1:154001570-154001592 CCTGGCATTATGAAGGAGATGGG + Intronic
915291869 1:154889751-154889773 CCAGACACTGTGGAGGGGAATGG - Intergenic
915566381 1:156715685-156715707 CCAGACATTGTGCAGAGGAAGGG + Intergenic
919786020 1:201259289-201259311 CCTGACACTGGGAAGAGGAAAGG + Intergenic
920581651 1:207114241-207114263 CCTGTAATTCTGATGGCGAATGG + Exonic
924258489 1:242205927-242205949 CCTGACATTAACAAGGAGAAAGG - Intronic
1063601524 10:7485565-7485587 CCTTCCATTCTGAAGGGGCATGG + Intergenic
1064300615 10:14119583-14119605 CCTGACATTCTGCATGCAAAAGG - Intronic
1065040846 10:21694504-21694526 ACTGAAAATCTGATGGGGAATGG - Intronic
1065046054 10:21748338-21748360 CCTCACATTCTGGAGTGAAATGG - Intergenic
1067089205 10:43258061-43258083 CCTGAGATCCTGAATGGGGAAGG - Intronic
1069681657 10:70290009-70290031 CCTGGAAGTCTGCAGGGGAATGG - Intergenic
1070675814 10:78410554-78410576 CCTGAGACACTGAAGGGAAAGGG - Intergenic
1072114407 10:92356003-92356025 ACTAACATTCTGAAGGGGTCAGG - Intergenic
1073353305 10:102835006-102835028 CCTGACAAACTGAAGGGAGAGGG + Exonic
1075141584 10:119842128-119842150 CCTGATGTTCTGAGGTGGAACGG + Intronic
1075925254 10:126246122-126246144 CCTTGCATTCTGGAGGAGAAAGG + Intronic
1076195906 10:128518047-128518069 CCTTACCCTCAGAAGGGGAAAGG + Intergenic
1076862561 10:133146290-133146312 ACTGGCATCCTGAAAGGGAAGGG + Intergenic
1077454928 11:2672789-2672811 CCAGCCCTTCTGAAGGGGACTGG - Intronic
1077772898 11:5240097-5240119 AGTGACATTCAGAAGGGCAAGGG + Intergenic
1079807761 11:24955941-24955963 AATGACTTTGTGAAGGGGAAAGG + Intronic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1083892504 11:65603204-65603226 ACTGAGGTTCTGAAGGGTAAGGG + Intronic
1084119554 11:67060915-67060937 CCTGTCATTGTGAAGGGCACTGG - Intronic
1084359097 11:68657978-68658000 CCAGACATGCGGCAGGGGAAAGG + Intergenic
1085340473 11:75727999-75728021 GCTCACATTCTGAACAGGAAGGG + Exonic
1085560465 11:77468111-77468133 CTTAACAGTCTGAAAGGGAAAGG + Intronic
1086242098 11:84707479-84707501 CCTGGACTTCTGAAGTGGAATGG + Intronic
1086913476 11:92499924-92499946 CCTGACATTTGTAAAGGGAATGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087169158 11:95032856-95032878 CCTGAAATTCTGGATGGGAGTGG - Intergenic
1088447878 11:109951739-109951761 CCCAACATTCGGAAGGGGAGAGG + Intergenic
1089162013 11:116445606-116445628 CCAGACAGGCTGGAGGGGAAGGG - Intergenic
1090793290 11:130111142-130111164 CCTGCCATTCTGAAGGGTTTGGG + Intronic
1091495489 12:968776-968798 GCTCACATTCTTATGGGGAAGGG - Intronic
1092835863 12:12487737-12487759 TCTGACATTTTGAATGTGAAGGG - Intronic
1093906226 12:24695148-24695170 GCTTACACTCTGGAGGGGAAGGG - Intergenic
1094676419 12:32625152-32625174 TCTGACATTGTAAAGGGAAAAGG - Intronic
1097408050 12:59215443-59215465 CCTGACAGTCTGTAAGGAAATGG + Intergenic
1097504001 12:60441241-60441263 CCTTACATGCTGGAGGGGATTGG + Intergenic
1098184276 12:67879603-67879625 CCTGACAGGCTTAAGGGGGATGG + Intergenic
1098852022 12:75607301-75607323 CCAAACATTGTCAAGGGGAAGGG - Intergenic
1099083953 12:78221900-78221922 CCTGGCATTCTGGAAAGGAAGGG + Intergenic
1101083644 12:101213786-101213808 CCTCACAATCAGAAGGAGAACGG - Intergenic
1101874153 12:108587946-108587968 GCTGTCATTCTAAAGGGGGAGGG - Intergenic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1103567543 12:121824060-121824082 CCTGAGGTTATGAAGGGGACAGG - Intronic
1104643649 12:130482696-130482718 GCTCACATTCTGCAGGGGAGGGG + Intronic
1106726459 13:32491132-32491154 TCTGAGATTCTGAAGGGAAAAGG + Intronic
1108924587 13:55724962-55724984 TCTGACATTCTTAAGAGGAAAGG - Intergenic
1109907336 13:68862049-68862071 AATGTCATTCTGAATGGGAAAGG - Intergenic
1110257777 13:73451156-73451178 CCTGACATTTTTTAGGGGTAAGG + Intergenic
1110838095 13:80108213-80108235 CCTTGCATTCTGAGGTGGAATGG + Intergenic
1112145476 13:96695317-96695339 TCAGACATTCAGAAGGGCAATGG - Intronic
1112759067 13:102672621-102672643 CCTGATTTTGTGAAGGAGAAAGG - Intronic
1113146020 13:107208434-107208456 CCTGGCATTCTGAATGTGTATGG + Intronic
1113245236 13:108388021-108388043 CCTAAAATCCTCAAGGGGAACGG - Intergenic
1113863808 13:113508435-113508457 CGTGATATTCGGAAGAGGAAGGG + Intronic
1117484566 14:56181380-56181402 ACTGGCATTCTTAAGGGGCATGG - Intronic
1119566598 14:75634392-75634414 CCTAACCTTATGATGGGGAATGG + Intronic
1121819009 14:96950997-96951019 CTAGACATTCTGGAAGGGAATGG + Intergenic
1122022049 14:98846227-98846249 CCTGTGACTCTCAAGGGGAAAGG - Intergenic
1125006370 15:34822256-34822278 CCTCACATGCTGAAGCGGGATGG - Intergenic
1126926120 15:53588569-53588591 ACTGACATTCTGATGGGAATGGG + Intronic
1128150834 15:65362619-65362641 TCAGTCATTCTGAAGGGGAGAGG - Intronic
1130876558 15:88019507-88019529 CCAGTCATTCTTAAGGGGAATGG - Intronic
1131098910 15:89672949-89672971 CCAGAGAATCTGCAGGGGAAGGG - Intronic
1131394546 15:92076311-92076333 CCTGAGGTTCTGACTGGGAAGGG - Intronic
1131882979 15:96878278-96878300 GGTGACATTCCCAAGGGGAAGGG - Intergenic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1132116413 15:99139258-99139280 CTTGAGATTCTGAATGGAAAGGG + Intronic
1132211310 15:100024669-100024691 CTTTACATTGTGAAGGGGCAAGG + Intronic
1133485907 16:6218200-6218222 CCTGGCATACTCAAGGAGAATGG - Intronic
1135652025 16:24214531-24214553 TCTGAGTTTCTGAAAGGGAAGGG + Intronic
1135663315 16:24315270-24315292 CCAGACATTCGGCAGGGGGAAGG + Intronic
1135902597 16:26476860-26476882 CCTGAAATTGTGATGCGGAATGG + Intergenic
1138463903 16:57172866-57172888 CTGGACATTCTGAAAGGAAAAGG + Exonic
1139576250 16:67843954-67843976 CCTGTGATTCTGATGGGGACTGG + Exonic
1140022836 16:71255121-71255143 CCTGAGATTCTTAAGAGGATGGG + Intergenic
1140323768 16:73980056-73980078 CCTGGCAGTTTGAAAGGGAAGGG + Intergenic
1140652237 16:77100665-77100687 CCTGACGATCTGAGGTGGAACGG + Intergenic
1140967933 16:79985237-79985259 CCTTATATTGTGAAGGAGAATGG + Intergenic
1140968736 16:79992617-79992639 ACAGACATTCTGATGGGGACAGG + Intergenic
1141616981 16:85215389-85215411 TCAGACACTCAGAAGGGGAAGGG + Intergenic
1141672332 16:85498846-85498868 CCTGCCACTCTGCAGGGGGAAGG - Intergenic
1143995515 17:11003299-11003321 GCTGACATTGTGAGGGTGAAGGG + Intergenic
1144487899 17:15682729-15682751 CCTGCCTTTCTGAAGGATAAGGG - Intronic
1144865160 17:18330901-18330923 CCTGACACTCCCATGGGGAAGGG + Intronic
1149614572 17:57987779-57987801 CCTCTCGCTCTGAAGGGGAAGGG - Intronic
1152147189 17:78575408-78575430 CCAGACAGTGTGAAGGGGATGGG + Intronic
1155218911 18:23666982-23667004 ACTGACATTCTGATAGGGAAAGG - Intergenic
1157078540 18:44495707-44495729 CCAGCCATTCTGAAGGAGGAAGG - Intergenic
1159076653 18:63688388-63688410 CCTGACATTGCTAAGGGGACTGG + Intronic
1159967138 18:74606046-74606068 CCTGACAATCTGAAGGGTTAGGG - Intronic
1160101389 18:75923055-75923077 GCTGATATTCTAAGGGGGAAGGG + Intergenic
1162914776 19:13868722-13868744 CCTGACATTTTAGTGGGGAATGG + Intronic
1165772664 19:38388066-38388088 CGGGACATTCTAAAGGGGAGGGG - Intronic
1166237095 19:41464546-41464568 CCTGACATTCAGAAGGGGAGAGG - Intergenic
1166237684 19:41468382-41468404 CCTAATATTCAGAAAGGGAAAGG - Intergenic
1166814816 19:45537551-45537573 CCTGCCAATCAAAAGGGGAAGGG + Intronic
1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG + Intronic
925913183 2:8586652-8586674 CTGGACATCCTGAAGGGGAATGG - Intergenic
927428312 2:23005430-23005452 CCTGGAATTCTGAAGGGACATGG + Intergenic
928293432 2:30060562-30060584 CATGCCATGCTGCAGGGGAATGG - Intergenic
928362237 2:30674405-30674427 CCTGAAATTTTATAGGGGAAAGG - Intergenic
929988158 2:46758419-46758441 ACTGAAATTCTGGACGGGAAGGG + Intronic
931275488 2:60740335-60740357 CCTGGGATTTTGAAGGGTAAGGG + Intergenic
934157229 2:89214740-89214762 CCTCAGCTTCTGAAGGGGAATGG - Intergenic
934210085 2:89968004-89968026 CCTCAGCTTCTGAAGGGGAATGG + Intergenic
935697229 2:105780770-105780792 CCTCACATGCTGAAGGGGTGAGG - Intronic
936228573 2:110679997-110680019 CCTGGCATCAAGAAGGGGAAAGG - Intergenic
938624859 2:133097146-133097168 CCTGCCATTGTGAAGGGTCAAGG - Intronic
938989335 2:136611920-136611942 GCTAACATTCTGAAGTGGTAAGG + Intergenic
941142258 2:161799589-161799611 ACTGGCATTGTGAAGGGAAAAGG + Intronic
941310856 2:163929199-163929221 CCTGGTATTTTTAAGGGGAAGGG + Intergenic
947956895 2:234200001-234200023 CCAGATATCCTGAAGGGGAAGGG - Intergenic
948656144 2:239477732-239477754 CCTGACCTTGGGAAGGGGACGGG - Intergenic
948815111 2:240506596-240506618 CCAGGCATTTGGAAGGGGAAGGG - Intronic
1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG + Intergenic
1172497082 20:35395206-35395228 CCTGACTTTTGGAAGGGGAGAGG - Intronic
1172616254 20:36287061-36287083 CCTGAAATTCAGTGGGGGAAAGG - Intergenic
1173077181 20:39830340-39830362 CAGGACATTCTGAAGGGTGAAGG - Intergenic
1173182682 20:40816519-40816541 CCTGCCAGACTGAAGGGGCAAGG - Intergenic
1176203587 20:63875922-63875944 CCTGACACTCAGTCGGGGAAGGG + Intronic
1178158553 21:29883678-29883700 TGTGACATTCTGAATGGGAATGG + Intronic
949426137 3:3918268-3918290 CCTCACAGTTTGAAGGGGCAGGG + Intronic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
950576893 3:13837423-13837445 GCTGACATTCAGGAGGGGAGGGG - Intronic
950704250 3:14770118-14770140 CCTGCCATTCTCAGGGGGCAGGG - Intronic
953476746 3:43211779-43211801 GCTCACATTCTGGAGGGGACAGG + Intergenic
954013254 3:47662417-47662439 CCTGACTGACTGAAGGGGACAGG + Exonic
954809708 3:53240441-53240463 CCTGACCTTCTGCAGAGGAAGGG - Intronic
955689532 3:61577799-61577821 CCCTACATTTTGAAGGGGTAGGG - Intronic
956272325 3:67461440-67461462 GATGGCATTCTGAGGGGGAAGGG + Intronic
956716408 3:72084210-72084232 CTTGTCAATCTGAAAGGGAATGG - Intergenic
958729878 3:97950125-97950147 CATGTCATTCCAAAGGGGAAGGG + Intronic
958923808 3:100136081-100136103 CTTGTCATTCTGAACTGGAAAGG - Intronic
959320438 3:104867083-104867105 CCTAACATTCTTGAGGGGAGAGG + Intergenic
960387455 3:117037020-117037042 CCTGACCTTCAGATGGGGAGGGG - Intronic
961073180 3:123956354-123956376 CCTGACTTTCTGAATCAGAATGG + Exonic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
963603691 3:147397028-147397050 CCTGACAGTGGGGAGGGGAAAGG + Intronic
965790279 3:172379882-172379904 ACTGACCTTCTGAAGTAGAAAGG - Intronic
967996157 3:195168240-195168262 CCTGTGATTCTGAACAGGAATGG + Intronic
969060757 4:4432470-4432492 CCTGCCACTCTCAAGGGTAAAGG + Intronic
973381103 4:49321653-49321675 CCTGAGATTCTGAGAGGGGAGGG - Intergenic
975190886 4:71460726-71460748 ACTGATATTCTGAAGGAGAAGGG + Intronic
976244091 4:82990150-82990172 CATGGCATTCTGAAGGAGGAAGG - Intronic
977314254 4:95425117-95425139 ACTGACCTTCTAGAGGGGAAAGG - Intronic
981833333 4:149027415-149027437 CCTGGCATTCTGTATGGTAAGGG - Intergenic
982115425 4:152094919-152094941 CCTGAAATCATGCAGGGGAAAGG - Intergenic
985180236 4:187252598-187252620 CCTGACCTTCTTAATGGGACAGG + Intergenic
986345221 5:6828564-6828586 AGTGACAATCAGAAGGGGAAAGG - Intergenic
991184269 5:63788998-63789020 CATGACATCCTGCAGGGGAAAGG - Intergenic
991270263 5:64770631-64770653 CCTTACATTCTATAGGGGGAAGG - Intronic
991776640 5:70091658-70091680 GCTGACACACTGAAGGGGCAAGG + Intergenic
991855927 5:70967105-70967127 GCTGACACACTGAAGGGGCAAGG + Intergenic
991869942 5:71099878-71099900 GCTGACACACTGAAGGGGCAAGG + Intergenic
992201942 5:74393469-74393491 CCACTCATTCTCAAGGGGAAGGG + Intergenic
993432662 5:87850970-87850992 CCTGTCATTATGGAGTGGAAAGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
998072735 5:139211036-139211058 CCTGATGATCTGAGGGGGAACGG + Intronic
998353474 5:141515869-141515891 TCTTACATTATGGAGGGGAAAGG + Exonic
1001997574 5:176174545-176174567 CCTGGCATCAAGAAGGGGAAAGG - Intergenic
1002045252 5:176537766-176537788 CCTGAGATACTGAAGTGCAATGG + Intronic
1002175651 5:177399748-177399770 CCTGACACCCTGATGGGGAGAGG + Intergenic
1002337669 5:178491431-178491453 CATGACTTTCTGCAGAGGAAGGG + Intronic
1002682802 5:180981520-180981542 CCTGAGAACCTGAAGGGTAAAGG + Intergenic
1008811008 6:55498913-55498935 CCTGACATTCTGATGGAGATTGG + Intronic
1009366886 6:62863222-62863244 CTTAATATTCTGAAGGGGAAAGG - Intergenic
1010166279 6:72918637-72918659 CTTGATTTTCTGGAGGGGAAAGG - Intronic
1012060074 6:94467191-94467213 CCCTACATTCTGAAGGGGCAAGG - Intergenic
1012715066 6:102658211-102658233 AATGACATTTAGAAGGGGAAGGG + Intergenic
1015139425 6:129912881-129912903 CCTGACAGGAGGAAGGGGAAAGG + Intergenic
1015329964 6:131965687-131965709 TCTAAAATTCTGAAAGGGAAAGG + Intergenic
1018723621 6:166592739-166592761 CCTTACATTCTACAGGGCAACGG + Intronic
1018937766 6:168284699-168284721 CCTGAAATAGGGAAGGGGAATGG - Intergenic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1027302768 7:76858359-76858381 CCTGTCATTCAGAAGAGAAATGG - Intergenic
1028538642 7:91917671-91917693 CCTGACCTTCAGAAAAGGAATGG + Intergenic
1029433340 7:100546710-100546732 CCTGACATTCTGAAGGGGAAGGG + Intronic
1030508120 7:110450310-110450332 CATGACCATCGGAAGGGGAAAGG - Intergenic
1034089646 7:148351970-148351992 CCGGCCATTCAGAAGGGGAGAGG + Intronic
1037941800 8:22957091-22957113 CTTGACATTTTGAAGGGTACTGG + Intronic
1040682280 8:49826889-49826911 GCTAACATTTTGAAGTGGAAAGG - Intergenic
1041482888 8:58342980-58343002 CCTGACATCCTGGTGGGGAGGGG + Intergenic
1042603650 8:70524864-70524886 CCTGACAGTTTGAAAGGCAAAGG - Intergenic
1042651192 8:71043182-71043204 CCTGACACTCTGCAAGTGAATGG + Intergenic
1044922120 8:97178042-97178064 CCTGACATTGAGCAGGGTAAGGG - Intergenic
1046336065 8:112788654-112788676 CCAGGCATTGTGAAGGGGATAGG - Intronic
1046937108 8:119895123-119895145 CCTGAAAGTCTGAAGGAGAGGGG - Intronic
1047435770 8:124834569-124834591 CCAGACATTCTGCAGGGGGTTGG - Intergenic
1048544117 8:135370173-135370195 CTTCACATTCTGAAGAAGAATGG + Intergenic
1050245706 9:3687821-3687843 TCTGTCATTCAGAAGGTGAAAGG - Intergenic
1050502323 9:6312006-6312028 TCTGACATTCTGCAGGTGGAAGG + Intergenic
1056200476 9:84270917-84270939 CTTGACATACTAAAGGGGAGGGG + Intergenic
1056997281 9:91474687-91474709 CCTAACACTCTGAAGGGGTTAGG + Intergenic
1057161196 9:92889490-92889512 CCTGAGATTCAGAAGGGTCAAGG - Intergenic
1057813792 9:98279101-98279123 CCTTACTTGGTGAAGGGGAAAGG + Intergenic
1058521250 9:105815848-105815870 CCTGATATCCAGAAGGGGAGAGG - Intergenic
1186394070 X:9190050-9190072 CCCGCCAGTCTGAAGGGGCAGGG + Intergenic
1186480254 X:9891117-9891139 CCTGGCATCCTGGACGGGAATGG - Intronic
1188313523 X:28646159-28646181 CCTGATGTTCTGAGGTGGAACGG - Intronic
1188678215 X:32969072-32969094 CCTCACATGGTGGAGGGGAAAGG - Intronic
1189503279 X:41584523-41584545 CCTGATAATCTGAGGTGGAACGG - Intronic
1189617057 X:42794648-42794670 ACAGACATTGTGAAGGGTAAGGG + Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1191863655 X:65686435-65686457 CCTGTTTGTCTGAAGGGGAAGGG - Intronic
1192457196 X:71286609-71286631 TCTGATATTCTAACGGGGAAAGG - Intronic
1195434359 X:104825427-104825449 CCTAACATTCTTGAGGGGAGAGG + Intronic
1195704973 X:107732138-107732160 GCTGAAATCCTGGAGGGGAAGGG - Intronic
1198324237 X:135551768-135551790 CTTGACATTAGGAAGAGGAAAGG - Intronic
1198421309 X:136472771-136472793 CCAGACATCCTGAAGGTGAGTGG - Intergenic
1198617659 X:138477357-138477379 CCTGATAATCTGAGGTGGAACGG - Intergenic
1199347384 X:146757481-146757503 CCTGACATTGTGCTGGGGTAGGG + Intergenic
1199997285 X:153033215-153033237 CCTGACATCCTGCAGGGCAGTGG + Intergenic
1201302044 Y:12516481-12516503 CCTGAAAATATGAATGGGAAAGG + Intergenic