ID: 1029435962

View in Genome Browser
Species Human (GRCh38)
Location 7:100564210-100564232
Sequence CCCCGAAGGAAGAGCCTAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029435962_1029435969 -2 Left 1029435962 7:100564210-100564232 CCCCCTAGGCTCTTCCTTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1029435969 7:100564231-100564253 GGACTTAGGATCAGCCAAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1029435962_1029435971 0 Left 1029435962 7:100564210-100564232 CCCCCTAGGCTCTTCCTTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1029435971 7:100564233-100564255 ACTTAGGATCAGCCAAGTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 130
1029435962_1029435970 -1 Left 1029435962 7:100564210-100564232 CCCCCTAGGCTCTTCCTTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1029435970 7:100564232-100564254 GACTTAGGATCAGCCAAGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 136
1029435962_1029435972 6 Left 1029435962 7:100564210-100564232 CCCCCTAGGCTCTTCCTTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1029435972 7:100564239-100564261 GATCAGCCAAGTTGGGGCAGAGG 0: 1
1: 0
2: 2
3: 14
4: 171
1029435962_1029435974 26 Left 1029435962 7:100564210-100564232 CCCCCTAGGCTCTTCCTTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1029435974 7:100564259-100564281 AGGCCACTGAGCCAGCCAGCTGG 0: 1
1: 1
2: 2
3: 39
4: 339
1029435962_1029435975 27 Left 1029435962 7:100564210-100564232 CCCCCTAGGCTCTTCCTTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1029435975 7:100564260-100564282 GGCCACTGAGCCAGCCAGCTGGG 0: 1
1: 0
2: 2
3: 25
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029435962 Original CRISPR CCCCGAAGGAAGAGCCTAGG GGG (reversed) Exonic
901501790 1:9657052-9657074 CCCAGAAGGAAGAGCAAAGCAGG - Intronic
902301022 1:15502835-15502857 CTCCGAAGGAAGAGCATTGCTGG + Intronic
905797016 1:40821461-40821483 CCACGTAGGAAGAGCCAGGGAGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
908208201 1:61872733-61872755 CCCCTAAGGAAAATCCTCGGAGG + Intronic
908633967 1:66141622-66141644 CCCAGAGGCAAGAGCCCAGGAGG - Intronic
914946249 1:152069227-152069249 CGCCGAAGGAATAGGCCAGGTGG - Intergenic
915299489 1:154943981-154944003 CCCAGAAGGAAGAGCTTCTGGGG - Intergenic
915756618 1:158267291-158267313 CCATGAAGGAAGAGCCCAAGAGG - Intergenic
918575221 1:186050460-186050482 CTGAGAAGGAAGAGCCTAAGAGG + Intronic
919101613 1:193103968-193103990 GCCCTAAGGAAGAGCATTGGTGG + Intronic
1071333346 10:84582715-84582737 CGCAGAAGGGAGAGCCCAGGGGG - Intergenic
1072041787 10:91613410-91613432 CCCCAAAGGAACTGCCTTGGTGG - Intergenic
1075083138 10:119397105-119397127 CCCAGAAGGAAGGGCTTAGCAGG + Intronic
1075103314 10:119520711-119520733 CCCCCCAGGAAGAGACTAGAGGG + Intronic
1076572238 10:131440569-131440591 CCCCGCAGGAAGGGCACAGGTGG + Intergenic
1077652825 11:3989406-3989428 CCGCCAAGGAAGAGCCCAAGAGG - Intronic
1078250573 11:9613587-9613609 CCCGAAAGGAAGAGCCCAGAAGG - Intergenic
1081683206 11:45023282-45023304 CTATGAAGGAAGAGCGTAGGGGG + Intergenic
1084598684 11:70132299-70132321 TCCCTTAGGAAAAGCCTAGGAGG + Intronic
1084955520 11:72689300-72689322 CCCCCAAGGAAGAGGCTGGTTGG + Intronic
1087141078 11:94767036-94767058 CACAGAAGGAAAAGCCTGGGAGG - Intronic
1089407090 11:118206725-118206747 GTCAGAAGGAAGAGCCTAGGAGG - Intronic
1089964782 11:122647025-122647047 GCCCTAAGGAAGCTCCTAGGAGG + Intergenic
1090570337 11:128038140-128038162 CCCCTATGCAAGAGCTTAGGGGG - Intergenic
1093057336 12:14568062-14568084 CCCCGGAGGGAGAGGCTAGTAGG - Exonic
1096080935 12:48831992-48832014 CTTGAAAGGAAGAGCCTAGGGGG + Intronic
1101813740 12:108129741-108129763 CCCGGCAGGAGGAGCCTTGGTGG + Intronic
1102564045 12:113783025-113783047 CCCCACAGGGAGAGCCGAGGAGG + Intergenic
1107668906 13:42722611-42722633 CCCCGCATCTAGAGCCTAGGTGG - Intergenic
1113398806 13:109973160-109973182 CCCAGAAGGAAGTGGCTAGCAGG - Intergenic
1119126384 14:72130987-72131009 TCCCCAAGGCAGAGCCTAGCAGG - Intronic
1122256445 14:100480984-100481006 CCACCAAGGAAGAGCCCAAGAGG + Intronic
1122493965 14:102139349-102139371 TCCCGAAGGGAGGGCCCAGGAGG + Exonic
1123116965 14:105899219-105899241 CCCCGAAGGAGGAACCAGGGAGG + Intergenic
1126981471 15:54249026-54249048 CCCTGTAGGAAGAGTCTAGCTGG - Intronic
1127786723 15:62362275-62362297 CCGCCAAGGAAGAGCCCAAGAGG - Intergenic
1129155810 15:73716907-73716929 CCCAGAAGGAGGAGACTGGGAGG + Intergenic
1131002903 15:88952591-88952613 CTGCCAAGGAAGAGCCCAGGAGG + Intergenic
1134275354 16:12770958-12770980 CCCCGAGGGAAGCACTTAGGGGG + Intronic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1136589244 16:31207499-31207521 CCCCAAAGGAAGGACCTGGGTGG - Intergenic
1140209497 16:72959530-72959552 TCCCGAAGGATGAGGCTATGTGG + Exonic
1141461279 16:84180028-84180050 CCTGGAAGGAAGAGACTGGGGGG + Exonic
1143275500 17:5706727-5706749 CCCTGCGGGAAGGGCCTAGGTGG - Intergenic
1144126377 17:12206674-12206696 CTCCGAAGGCAGAGCCTTTGTGG + Intergenic
1144734169 17:17545592-17545614 CCCCGCAGAAAGAGCAGAGGAGG - Intronic
1154413032 18:14151780-14151802 CCCCCAGGGGAGTGCCTAGGTGG - Intergenic
1161321552 19:3643907-3643929 GCCCCAGGGAAGAGCCCAGGGGG - Intronic
1162379413 19:10322871-10322893 GCCCAAAGGAAGGGCCTAGAAGG + Intronic
1163782197 19:19256509-19256531 TCCACAAGGAAAAGCCTAGGGGG + Exonic
1164639409 19:29812830-29812852 CCCCGTAGGCAGAGCCAAGTCGG - Intronic
1166404071 19:42506712-42506734 CCCCTAATGAAGAGGCTGGGAGG + Intergenic
1168042308 19:53768497-53768519 CCGCCAAGGAAGAGCCCACGAGG - Intergenic
929267928 2:39940031-39940053 ACCAGAAGGTAGAGCCTTGGGGG - Intergenic
930526976 2:52542602-52542624 CCCAGAAGGAGTAGACTAGGGGG + Intergenic
932346018 2:70995448-70995470 CCCCAAAAGAACAGCCTAGAGGG - Intergenic
932794171 2:74680564-74680586 GCCGGAAGGAAGAGCCCTGGAGG + Exonic
933747920 2:85584400-85584422 CCCCGGAGGAAGAGCAGGGGCGG - Exonic
934550796 2:95260409-95260431 CCCAGGAGGAAGAGCTGAGGGGG - Intergenic
935976529 2:108584365-108584387 CACCCAAGGAAAAGTCTAGGGGG - Intronic
937139336 2:119585938-119585960 CCCAGAAGGTAGAGCCCAGCTGG + Intronic
945373507 2:209051427-209051449 CCCAGAAGGAAGATCTTAGATGG - Intergenic
1169908842 20:10630527-10630549 CCCAGTAGGAGGAGCCTAGAGGG + Intronic
1170136268 20:13076849-13076871 CAGCAAAGGAAGAGCCCAGGAGG + Intronic
1173602138 20:44303407-44303429 CTCCCAAGGAAGAGGCAAGGGGG + Exonic
1175499670 20:59440939-59440961 CCCAGAAAGGAGAGACTAGGGGG - Intergenic
1179785768 21:43728860-43728882 CCCCGCAGGAAGTTCCCAGGAGG + Intronic
952239621 3:31516978-31517000 CCACGAAGGAAGAGCCTGCCTGG + Intergenic
963467852 3:145704995-145705017 CCCAGAAGGAAGAGTCTCTGGGG - Intergenic
967225718 3:187289177-187289199 CCCCGTAGGAACAGGCTAGCAGG + Intronic
970319620 4:14862653-14862675 TCCCGGAGGAGGAGCCCAGGAGG + Intergenic
971252063 4:24981234-24981256 CCCCCAAGGAAGAGCTTGGCAGG + Intergenic
974486329 4:62510503-62510525 CCGCCAAGGAAGAGCCCAAGAGG + Intergenic
976660474 4:87535384-87535406 CCCCGAGGGCAGAGCCTCTGAGG - Intergenic
983905877 4:173182705-173182727 CCCCGAATGATGAGGCTAGCAGG + Intronic
984913140 4:184694240-184694262 CCCCGACGGAAGAGCAAGGGTGG - Intronic
989572122 5:42954459-42954481 ACCAGAAGGAACAGCCCAGGCGG + Intergenic
1003251682 6:4433984-4434006 CCCCCATGGAAGAGCCCAGAGGG - Intergenic
1005832305 6:29680786-29680808 CCCAGAAGGAAGATTCTGGGCGG - Intronic
1006506230 6:34490557-34490579 TCCTGAAGGAAGAGGCCAGGTGG - Intronic
1008146608 6:47898997-47899019 CCCTGAAGGAAGAGTGTAAGAGG - Intronic
1017316332 6:153035786-153035808 CCCTGAAGGAGGAGCATATGGGG + Intronic
1018322353 6:162624982-162625004 CCCAGAAGGAAGGGCATAGTAGG - Intronic
1021651483 7:22837624-22837646 CCCCGAAGTGGGAGCCTGGGTGG - Intergenic
1022242799 7:28529298-28529320 CCCCGAAGGAGGTGCCAAGGTGG + Intronic
1023931595 7:44709541-44709563 CCCCTGAGGAAGAGCTTAAGTGG + Intergenic
1029435962 7:100564210-100564232 CCCCGAAGGAAGAGCCTAGGGGG - Exonic
1031709997 7:125033710-125033732 ACCCGAAGCAGCAGCCTAGGTGG + Intergenic
1035326256 7:158067969-158067991 CCCCACAGGAAGAGCCTCAGCGG - Intronic
1035659322 8:1334899-1334921 CCCCGCAGGGAGGGCCAAGGCGG - Intergenic
1037393234 8:18416427-18416449 CCCAGAGGGCAGAGGCTAGGGGG - Intergenic
1037877353 8:22554578-22554600 CCCGGGAGGAAGACCCTATGTGG - Exonic
1038994498 8:32906579-32906601 CCCTGAAGGAAGAGCACAGAAGG - Intergenic
1039828654 8:41195474-41195496 CTCAGAAGGATGAGCCTGGGTGG - Intergenic
1042877065 8:73449329-73449351 CCCAGAAGGAAGGCCCTGGGAGG - Intronic
1044291576 8:90477553-90477575 CCCAAAAGGAAGAGACTTGGGGG - Intergenic
1044331830 8:90929573-90929595 CCCAGAAGGAAGAGTCTGGTTGG + Intronic
1048980762 8:139702519-139702541 CCCCGAAGGGTGAGGCTCGGAGG + Intronic
1049620077 8:143594194-143594216 CCCTCAGGGAAGAGCCTTGGTGG - Intronic
1053398641 9:37798923-37798945 CTCTGCAGGAAGACCCTAGGGGG + Intronic
1059441489 9:114309494-114309516 CCCCACATGAAGGGCCTAGGAGG - Intronic
1062028276 9:134350516-134350538 GCCCGAAGGAAGACACTAGCCGG - Intronic
1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG + Intronic
1062717952 9:138020629-138020651 CCCGGAAGGAACAGGCCAGGTGG + Intronic
1185469513 X:374077-374099 CCCCGAGAGGAGAGCCTGGGCGG + Intronic
1185469522 X:374117-374139 CCCCGAGAGGAGAGCCTGGGCGG + Intronic
1187475834 X:19610017-19610039 TCCCTAAGGAAGACCCTAAGGGG - Intronic
1192217628 X:69174152-69174174 CCGCCAAGGAAGAGCCCAAGAGG + Intergenic
1195644540 X:107214023-107214045 ACCCTAAGGAAGAGCTTAGGTGG + Intronic
1197962711 X:132023509-132023531 CCCCGATCGAAAAGCCTGGGAGG + Intergenic
1200285378 X:154817345-154817367 CCGCCAAGGAAGAGCCCAAGAGG - Intronic
1202093673 Y:21221292-21221314 CTCTGAAGAAAAAGCCTAGGAGG - Intergenic