ID: 1029436204

View in Genome Browser
Species Human (GRCh38)
Location 7:100565329-100565351
Sequence CTCATGGACGGGAGCGCAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029436190_1029436204 26 Left 1029436190 7:100565280-100565302 CCCCTGTGGAACAGCTCTTCCCT 0: 1
1: 0
2: 1
3: 24
4: 218
Right 1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 45
1029436195_1029436204 7 Left 1029436195 7:100565299-100565321 CCCTGGGCCTAGCTCGCCAGCGC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 45
1029436192_1029436204 24 Left 1029436192 7:100565282-100565304 CCTGTGGAACAGCTCTTCCCTGG 0: 1
1: 0
2: 1
3: 21
4: 175
Right 1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 45
1029436197_1029436204 0 Left 1029436197 7:100565306-100565328 CCTAGCTCGCCAGCGCTGTGCTC 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 45
1029436191_1029436204 25 Left 1029436191 7:100565281-100565303 CCCTGTGGAACAGCTCTTCCCTG 0: 1
1: 0
2: 2
3: 22
4: 230
Right 1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 45
1029436199_1029436204 -9 Left 1029436199 7:100565315-100565337 CCAGCGCTGTGCTCCTCATGGAC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 45
1029436196_1029436204 6 Left 1029436196 7:100565300-100565322 CCTGGGCCTAGCTCGCCAGCGCT 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029436204 Original CRISPR CTCATGGACGGGAGCGCAGT GGG Exonic
901439889 1:9271537-9271559 CTCATGGGAGAGAGAGCAGTGGG + Intergenic
901988480 1:13093593-13093615 CTCCTGGATCAGAGCGCAGTTGG - Intergenic
901993332 1:13133174-13133196 CTCCTGGATCAGAGCGCAGTTGG + Intergenic
903265693 1:22156691-22156713 CCTATGGATGGGAGAGCAGTGGG - Intergenic
903872962 1:26450194-26450216 CTCCTGGGCTGGAGTGCAGTGGG + Intronic
906637591 1:47419437-47419459 CTCTTTGAGGGGAGGGCAGTAGG + Intergenic
912161170 1:106986893-106986915 CTCATCCAAGGGAGCACAGTTGG + Intergenic
914032459 1:143973017-143973039 CTCACGGACCGCAGCGCAGCCGG + Intergenic
914156987 1:145094950-145094972 CTCACGGACCGCAGCGCAGCCGG - Intronic
920467939 1:206203901-206203923 CTCACGGACCGCAGCGCAGCCGG + Intronic
1070751532 10:78966879-78966901 CTCATGGGCAGGAGGGCAGATGG - Intergenic
1073442324 10:103559437-103559459 CTGCTGGACGGCAGGGCAGTTGG + Intronic
1080934399 11:36847193-36847215 CTCATGAAGGGGAGCACAGGAGG - Intergenic
1081610049 11:44556522-44556544 CTCTTGGGCTGGAGCGCAGTGGG + Intergenic
1094662981 12:32489221-32489243 CTCCTGGACAGGAGTCCAGTTGG - Intronic
1112003773 13:95236640-95236662 CTCATGGAAGGCAGTGCAGTTGG - Intronic
1112296873 13:98195573-98195595 CACAAGGAAGGGAGGGCAGTGGG + Intronic
1113536160 13:111067637-111067659 CTCACGGGCGGCAGCGCAGTCGG - Intergenic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1135573280 16:23565857-23565879 CTCAGGGACGGGGGCGCAGGGGG - Intronic
1136064025 16:27746792-27746814 ATCATGGTGGGGAGCGCAGAGGG + Intronic
1203145207 16_KI270728v1_random:1794461-1794483 CTCGTGGACGGCAGCGCTGTGGG - Intergenic
1152545935 17:81000138-81000160 CTCGTGGACTTGGGCGCAGTGGG + Intronic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1162001618 19:7747752-7747774 CTCATGGATGGCTGAGCAGTGGG + Intergenic
1164707242 19:30329004-30329026 CTCATGCAAGGGAGCTCTGTTGG + Intronic
1167724248 19:51200005-51200027 CTCAGGGACGGCAGCACAGGTGG + Intergenic
932485039 2:72079688-72079710 CTCAGGCACAGGAGCACAGTAGG - Intergenic
937994672 2:127684097-127684119 CACATGGACAGAAGCGCAGTGGG - Intergenic
1174161174 20:48551564-48551586 ATCATGGACGGGAGGGAAGCAGG - Intergenic
1182352079 22:29704804-29704826 CTCAGGGTTGGGAGGGCAGTGGG + Intergenic
1183512892 22:38246142-38246164 CACAGGGACGGGAGGGCAGGTGG + Intronic
949721049 3:6990544-6990566 TTCATGGACGGGGGCTGAGTTGG + Intronic
950058884 3:10052556-10052578 CTCCTAGACTGGAGTGCAGTTGG + Intronic
951251018 3:20394511-20394533 CTCATGGGAGGGAGCACAGGGGG - Intergenic
955102212 3:55861302-55861324 CTCATGGAAGCCAGCGCAGCTGG + Intronic
963911941 3:150822433-150822455 CTCATAGGCTGGAGTGCAGTGGG + Intergenic
967323884 3:188219936-188219958 CTAATGGATGGGAGAGCAGGTGG - Intronic
985703197 5:1386007-1386029 CTCATGGAACGGGGTGCAGTGGG + Intergenic
985918349 5:2945719-2945741 CTGAAGGACGGGAAAGCAGTGGG + Intergenic
986643408 5:9893356-9893378 CTCATGGACAGAAGCACAGGTGG - Intergenic
993402005 5:87465410-87465432 CTCAGGGAAGGGAGAGCATTAGG - Intergenic
1003612792 6:7628658-7628680 CTCATGGAAGGCAGGGAAGTGGG + Intergenic
1018745087 6:166755523-166755545 CTCAAGGAGTGGAGCGCAGCAGG - Intronic
1019675350 7:2308690-2308712 GTCATGGAAGGGAGCGAAATGGG + Intronic
1023749891 7:43362380-43362402 CTCATAGCGGGAAGCGCAGTGGG + Intronic
1023874942 7:44281845-44281867 CCCCTGGCCGGGAGAGCAGTGGG - Intronic
1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG + Exonic
1050295920 9:4205133-4205155 CCCAGGGACTGGAGTGCAGTGGG - Intronic
1052917366 9:33933586-33933608 CTCACAGACGGGAGGGCAGAGGG + Exonic
1057841242 9:98487014-98487036 CTCAAGGAAGGGAGCGAAGAGGG + Intronic
1060776155 9:126376459-126376481 CTCATGGGCTGGAGCCCTGTGGG + Intronic