ID: 1029436495

View in Genome Browser
Species Human (GRCh38)
Location 7:100566853-100566875
Sequence TCCTTTCTGCTTAGAGCCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029436489_1029436495 24 Left 1029436489 7:100566806-100566828 CCTAGATTATCTCTGTGTCCCTC 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1029436495 7:100566853-100566875 TCCTTTCTGCTTAGAGCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 96
1029436492_1029436495 -1 Left 1029436492 7:100566831-100566853 CCTAATTCTCTTACCAGTTCTTT 0: 1
1: 0
2: 2
3: 46
4: 432
Right 1029436495 7:100566853-100566875 TCCTTTCTGCTTAGAGCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 96
1029436491_1029436495 5 Left 1029436491 7:100566825-100566847 CCTCTACCTAATTCTCTTACCAG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1029436495 7:100566853-100566875 TCCTTTCTGCTTAGAGCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 96
1029436488_1029436495 25 Left 1029436488 7:100566805-100566827 CCCTAGATTATCTCTGTGTCCCT 0: 1
1: 0
2: 0
3: 28
4: 251
Right 1029436495 7:100566853-100566875 TCCTTTCTGCTTAGAGCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 96
1029436487_1029436495 28 Left 1029436487 7:100566802-100566824 CCACCCTAGATTATCTCTGTGTC 0: 1
1: 0
2: 3
3: 12
4: 149
Right 1029436495 7:100566853-100566875 TCCTTTCTGCTTAGAGCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 96
1029436490_1029436495 6 Left 1029436490 7:100566824-100566846 CCCTCTACCTAATTCTCTTACCA 0: 1
1: 0
2: 1
3: 10
4: 208
Right 1029436495 7:100566853-100566875 TCCTTTCTGCTTAGAGCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029436495 Original CRISPR TCCTTTCTGCTTAGAGCCGG AGG Exonic
901196114 1:7440687-7440709 TCCTGCCTGCTTGGAGCCTGTGG + Intronic
905861990 1:41358050-41358072 CCCTCTCTGCTTTCAGCCGGGGG + Intergenic
909180722 1:72420366-72420388 ACCTTTCAGCTTCGAGCCAGGGG + Intergenic
909859491 1:80587204-80587226 TCCTTGCTGCCTACAGCCTGGGG + Intergenic
917780461 1:178390252-178390274 TCCTTTCTTCTTAGAGTTAGGGG + Intronic
918315410 1:183318658-183318680 TCCTTCCTGCCTTGAGCCAGAGG + Intronic
920271495 1:204768218-204768240 TCCTGCCTGCTTTAAGCCGGTGG + Intergenic
1062866650 10:861173-861195 TCCTTTCTCCGTGGAACCGGTGG - Intronic
1073223122 10:101893062-101893084 TCCTTTCTGCTTATGGGCTGTGG - Intronic
1076410075 10:130242743-130242765 TCTTCCCTGCTTAGAGCCTGGGG - Intergenic
1077300585 11:1844720-1844742 TCCTTTCTGCTAGGAGGCCGTGG + Intergenic
1078702135 11:13696540-13696562 TATTTTCTACTTAGAGCCTGAGG + Intronic
1080120230 11:28668275-28668297 TACTTTCTGCTCACAGCCAGTGG + Intergenic
1080295540 11:30723132-30723154 TCCTTGCTGCTTGTAGCCGATGG - Intergenic
1081296394 11:41394978-41395000 TCATTTCTGCTGAGAACAGGGGG + Intronic
1083324668 11:61867159-61867181 TCCTGGCTGCTTAGAGCTGGGGG - Exonic
1087672854 11:101127905-101127927 TCCTTTATCTTTAGAGCGGGCGG + Exonic
1088621993 11:111694440-111694462 TCCTTTCTGATTTGAGGCAGTGG + Intronic
1092746325 12:11675805-11675827 TCCTTTTTGTTTAGAGACAGAGG - Intronic
1096602729 12:52742016-52742038 TGCTTTCTCCTTAGAACAGGAGG - Intergenic
1097595269 12:61621169-61621191 AGCATTCTGCTTAGAGCCTGAGG + Intergenic
1100336836 12:93639545-93639567 CCCTTTCTCCTGAGAGCTGGTGG + Intergenic
1102184572 12:110937590-110937612 TCCTTCCTGCTGGGGGCCGGTGG + Intergenic
1103602228 12:122061604-122061626 ACCTTTCAGCTTCGAGCCAGGGG + Exonic
1107709178 13:43135382-43135404 TCCTTCCTGCTTGGAACCCGGGG - Intergenic
1109651953 13:65338522-65338544 TCCTTTTCACTTAGAGCCTGTGG - Intergenic
1113002497 13:105658415-105658437 TCCTTCTTTCTTAGAGCCGCAGG + Intergenic
1117712914 14:58550899-58550921 TCCTTTCTGCTGGGTGCGGGTGG + Intronic
1121945571 14:98118411-98118433 GCATTTCTGCTTAGAGCCATTGG - Intergenic
1124035719 15:26052139-26052161 TCCTGTCAGCAAAGAGCCGGAGG - Intergenic
1129785133 15:78304734-78304756 TTCTTTCTGCTGAGAGCAGCAGG + Intergenic
1135477608 16:22790692-22790714 TCCTTTTAGCTTAAAGCAGGCGG - Intergenic
1137754273 16:50889007-50889029 TTCTTTCTGCTGAGAGCCTGTGG + Intergenic
1139185281 16:64799038-64799060 TCCTTTGTTCTTAGAGTAGGAGG + Intergenic
1139510066 16:67422520-67422542 TCCATTCTCCTTACAGCCTGTGG + Intergenic
1140222448 16:73053763-73053785 GCCTTTCAGCTCAGAGCCTGTGG - Intronic
1144560222 17:16315195-16315217 TCCTTCGTGCTGAGAGCCTGTGG - Intronic
1146956249 17:36937872-36937894 ACCCTTCTGCTCAGAGCCCGCGG - Exonic
1147211036 17:38872545-38872567 TCCTTACTGCCTGGAGCAGGTGG - Intronic
1149528080 17:57373497-57373519 TCCTTTCTGCTTAAACCAGATGG - Intronic
1152694765 17:81738583-81738605 TCCTTGATGCTGAGGGCCGGTGG + Intergenic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1157163540 18:45337078-45337100 CCCATCCTGCTTAGAGCTGGAGG - Intronic
1157915571 18:51660725-51660747 TCCTTTTTGCTTAGTGGGGGTGG + Intergenic
1158264672 18:55648988-55649010 CACTTTCTGCTGAGAGCCAGTGG + Intronic
1165852909 19:38860901-38860923 CTATTTCTGCTTGGAGCCGGAGG - Intergenic
1166996644 19:46722676-46722698 TCCTTCCTGCTCAGGGCCTGAGG + Intronic
925221572 2:2145930-2145952 TCCTTTCTGCTTAGAATGTGAGG + Intronic
925252846 2:2455775-2455797 TCATTCTTGCTTAGGGCCGGGGG + Intergenic
927226224 2:20767932-20767954 TCCTCTCTGCTGAGAGCTGCAGG + Intronic
927279776 2:21294359-21294381 TGTTTTGTGCTTAGAGCTGGGGG - Intergenic
939167619 2:138656125-138656147 TCCTTTCTCCTTCAAGCCTGGGG + Intergenic
942623913 2:177878327-177878349 TCCTCTCTCCTTAAATCCGGTGG + Intronic
946567543 2:220983546-220983568 TCTTTTCTGCTTAAAGCCATCGG - Intergenic
947181005 2:227411442-227411464 TACTGTCTGCTTAGATCCTGAGG + Intergenic
948185008 2:236014123-236014145 TCCTTTCTCCTGAGAACCTGAGG + Intronic
1171356018 20:24546016-24546038 TTCCTTCTGCTCAGAGCCTGTGG - Intronic
1172561366 20:35891521-35891543 TCTTTTCTGCTGAGAGACCGGGG + Intronic
1172620948 20:36318288-36318310 CCCCTTCTGCTTAGAGCCCCAGG - Intronic
1173044517 20:39496937-39496959 TACCTTCTTCTTAGAGCTGGAGG - Intergenic
1174198492 20:48790418-48790440 TCCTTTTTCCTTGGAGCCTGGGG - Intronic
1175248728 20:57596622-57596644 TCCTTTCTTCGTGGAGTCGGTGG + Intergenic
1178855033 21:36243677-36243699 TCCTTTCTTTTTAGAGACAGGGG + Intronic
1180859908 22:19072246-19072268 TCCTATCTGCCTGGAGCCTGGGG - Intronic
1183105444 22:35611909-35611931 TCCTTCCTGCTGTGAGCAGGTGG + Intronic
1184192637 22:42904964-42904986 TCCTTTCATTTTAGAGCCGGTGG - Intronic
957678644 3:83403897-83403919 TGCCTTCTCCTTAGAGCTGGAGG - Intergenic
962747197 3:138405694-138405716 TCCTTCCTGCATGGAGCTGGAGG + Intergenic
968538629 4:1150909-1150931 TCCTCTCTGCTGAGAGCCGCAGG - Intergenic
970354396 4:15237700-15237722 TATTTTCTGCTTGGAGCCAGTGG - Intergenic
972025526 4:34371691-34371713 ACCTATGTGCTTAGAGCCAGTGG + Intergenic
976326377 4:83776422-83776444 TCCTCTCTCTTTAGATCCGGAGG + Intergenic
978426332 4:108586759-108586781 TGCTTTCTGTTTGGAACCGGAGG - Intergenic
980180271 4:129392955-129392977 TCCTCTCTGCTGAGAACTGGGGG + Intergenic
980306234 4:131064745-131064767 TCCTCTCTGCTGAGAGCTGAGGG - Intergenic
988374293 5:30414203-30414225 TCCTTTGTGCTTGGAGTAGGAGG + Intergenic
999128512 5:149264849-149264871 TCCCTTGGGCTTAGAGCCTGTGG + Intergenic
1002469984 5:179429330-179429352 CCCTTTCTTCTGAGAGCCTGGGG - Intergenic
1005498719 6:26411752-26411774 CCCTTTCTGCTGAGAGCCCAGGG + Intronic
1006896578 6:37475219-37475241 TCCATTCTGCCTACAGCTGGGGG - Intronic
1007368951 6:41413668-41413690 CCATTTCTGCTTAGAGGCAGGGG - Intergenic
1009819469 6:68781724-68781746 GCCTACCTGCTTAGAGCTGGAGG + Intronic
1012893300 6:104921121-104921143 TCCTTTTTGCTTAGAGTCCCAGG - Intergenic
1013642553 6:112100749-112100771 TCCTTGCTGCTTTGTGCAGGTGG - Exonic
1017421703 6:154279630-154279652 TCCTTTATGGTTAGAACCAGTGG - Intronic
1017774408 6:157669668-157669690 TCCTTGTTCCTTAGAGCCAGGGG + Intronic
1017971378 6:159315308-159315330 TCCTTGCTGCTTTGGCCCGGTGG - Intergenic
1021021104 7:15599753-15599775 TCCTCTCTGCTGAGAGCTGAAGG - Intergenic
1023121810 7:36916791-36916813 TTCTGTCTCCTTAGAGCAGGAGG - Intronic
1026015194 7:66666649-66666671 TCCTGGCTGCTCACAGCCGGCGG + Intronic
1026225231 7:68434513-68434535 TCCTCTCTGCTCATAGCTGGTGG + Intergenic
1028317380 7:89420418-89420440 TCCTTTCTGGTTAGAAGAGGTGG - Intergenic
1029436495 7:100566853-100566875 TCCTTTCTGCTTAGAGCCGGAGG + Exonic
1033319173 7:140324395-140324417 TCCTTGCGGCTGAGAGCCTGGGG + Intronic
1036754388 8:11462769-11462791 TGCTTTCTGCTTCGAGGCAGTGG - Intronic
1044988705 8:97776463-97776485 TCCTTTCTTCTTAAAGCCCGTGG + Intronic
1049320820 8:141995270-141995292 TCCTTTGTGCTTAGAAGGGGAGG - Intergenic
1055282524 9:74690849-74690871 TCCCTTCTTCATAGAGCCAGGGG + Exonic
1056558850 9:87712207-87712229 TCCTTTCTGCTCAGCGGAGGTGG - Intergenic
1186793280 X:13019695-13019717 TCCTTTCTGCTAAAAGCTGTAGG + Intergenic
1188941550 X:36243457-36243479 TCCTTTTTACTTTGAGCCTGTGG - Intronic
1189321902 X:40092047-40092069 TCCTTTCGGCCTCGGGCCGGAGG + Intronic