ID: 1029440200

View in Genome Browser
Species Human (GRCh38)
Location 7:100583130-100583152
Sequence TTCCCAGGTCCCTCCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029440191_1029440200 30 Left 1029440191 7:100583077-100583099 CCAAGGGCTGGGAGGGAAGGGCA 0: 1
1: 1
2: 16
3: 96
4: 714
Right 1029440200 7:100583130-100583152 TTCCCAGGTCCCTCCCATCTGGG 0: 1
1: 0
2: 2
3: 31
4: 285
1029440197_1029440200 1 Left 1029440197 7:100583106-100583128 CCTGGTTGGAGATGGGAGCTGGA 0: 1
1: 0
2: 0
3: 30
4: 266
Right 1029440200 7:100583130-100583152 TTCCCAGGTCCCTCCCATCTGGG 0: 1
1: 0
2: 2
3: 31
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029440200 Original CRISPR TTCCCAGGTCCCTCCCATCT GGG Intronic
900302852 1:1986591-1986613 CCCCCAGGCCCCTCCCACCTGGG + Intronic
900573296 1:3370637-3370659 TGCCCTGGTCCCTCACATCAGGG - Intronic
900626965 1:3612738-3612760 TTCCCAAGCCCCTCCCAGCCAGG - Intergenic
901476468 1:9493479-9493501 TTCTCAGTTCACTCCCATCATGG + Intergenic
901635605 1:10668810-10668832 TTCCCAGGTTCATCCCTGCTAGG - Intronic
902277561 1:15350508-15350530 CGCCCTGGTGCCTCCCATCTTGG - Intronic
902556758 1:17251279-17251301 TTCTGAGGTCCCTCCCGGCTTGG + Intronic
902856714 1:19211490-19211512 GTCCTAGGTTCCTCCCACCTTGG + Intergenic
903179233 1:21597133-21597155 TCCCCATGGCCCACCCATCTGGG - Exonic
903235029 1:21944593-21944615 CTCCCAGGCCCCTCCCAACAGGG - Intergenic
903364865 1:22799921-22799943 TTCCCAGTTCCCTCCCTTAAAGG + Intronic
904798692 1:33077268-33077290 TTCCCACCTCCCTCGCAACTAGG + Intronic
904857393 1:33509618-33509640 TTCCCGGCGCCATCCCATCTAGG - Intergenic
905474858 1:38218888-38218910 ATCCCAGGTGCTTCCCACCTGGG - Intergenic
906220382 1:44073679-44073701 TGCTCAGGTCCCTCCCAGCCAGG - Intergenic
907724604 1:57007496-57007518 TTCCCCCTACCCTCCCATCTGGG - Intronic
908855408 1:68421313-68421335 TTCCCAGACCCCTCCTATCCTGG + Intergenic
909072051 1:71006227-71006249 GTCCCTGGTTCCTCCCATGTGGG - Intronic
909663659 1:78110627-78110649 TTTCCAAGTCCCTCCCACCTAGG - Intronic
910538208 1:88324048-88324070 CTACCAGGTCCCTCCCATGATGG + Intergenic
911239354 1:95448776-95448798 GGCCCAGGTCCCTCCCTTCAGGG + Intergenic
912070019 1:105797550-105797572 TTCCCAGGCCCCTTGCATCTAGG + Intergenic
912430871 1:109627718-109627740 TCCCCAGGTGCCTCCCTTCAGGG + Intronic
912529787 1:110312021-110312043 TTCCCAGCTCTCTCTCATCCTGG - Intergenic
915932818 1:160070355-160070377 TGCCCAAGACCCTCCAATCTCGG - Intergenic
916499709 1:165376251-165376273 TTCCCAGCCCCCTCCCTTCTCGG - Intergenic
916687823 1:167163005-167163027 CTCTCAGGTCCCTCCCCTTTTGG + Intergenic
917799025 1:178553355-178553377 TTTCCAGAGCCCTCCCATTTAGG + Intergenic
918234109 1:182562040-182562062 TTCCCAGGCCCATCCCATTTTGG - Intergenic
919772726 1:201173001-201173023 TTCCCAGGCCCATCCCTGCTGGG - Intergenic
920108437 1:203570578-203570600 TTCCCTGGTCCCTCTTATCTTGG - Intergenic
920295054 1:204950883-204950905 TTCCCAGATCCTCCCCTTCTAGG - Intronic
920375647 1:205506367-205506389 TTCCCAGGACTCTCCCCACTGGG + Intronic
920729705 1:208471651-208471673 TTCCCACCTCCCTCCCCACTTGG - Intergenic
920846396 1:209596260-209596282 CTCTCTGGTCACTCCCATCTTGG - Intronic
921216180 1:212938659-212938681 TGACCAGCTCCCTCCCATCCTGG + Intergenic
921346778 1:214194361-214194383 TTCACAGTGCCCTTCCATCTGGG + Intergenic
1063217599 10:3938335-3938357 CTCCCAGCTCCCTACCAGCTTGG - Intergenic
1064897353 10:20253129-20253151 TTCAAAGGACCCTCCCGTCTCGG - Intronic
1065145630 10:22764861-22764883 TTGTCAGATTCCTCCCATCTTGG - Intergenic
1068918518 10:62459427-62459449 TTCTCTGTTCCCTCCCATCTGGG - Intronic
1069042917 10:63713233-63713255 ATCCCAAACCCCTCCCATCTGGG + Intergenic
1069173383 10:65260683-65260705 TTCCCAGGAGCGTCCCTTCTGGG - Intergenic
1069753816 10:70761327-70761349 TTCCCAGGCCCCCCTCCTCTCGG - Exonic
1070436216 10:76396560-76396582 TTTCCAGGTCACTGACATCTTGG - Intronic
1072551403 10:96480299-96480321 GTCCCTCATCCCTCCCATCTGGG + Intronic
1072693488 10:97586709-97586731 TTCTCTGGACCCTCCCTTCTGGG + Intronic
1073225976 10:101919387-101919409 TTCCCAGCTCCCTCTCTGCTTGG + Intronic
1075274900 10:121084635-121084657 TTCCCAGGTCACCATCATCTTGG + Intergenic
1076154750 10:128195135-128195157 GTCCAGGGTCCCTCCCAGCTTGG + Intergenic
1076530306 10:131140530-131140552 ACCTCAGGTCCCCCCCATCTAGG + Intronic
1076875411 10:133213354-133213376 TTCCCAGGTCCCTGCCATCCCGG + Intronic
1076981722 11:208373-208395 TTCCCAGGTCCCTGCCTTTGTGG - Intronic
1079133157 11:17761319-17761341 TTCCCACCTCCCTCACCTCTTGG + Intronic
1080456359 11:32423181-32423203 TTCCCTGGTACCTTCCCTCTGGG + Intronic
1080633628 11:34104575-34104597 TTGCCAGGACTCCCCCATCTTGG + Intergenic
1080837554 11:35953907-35953929 TCCCCAGGTTCCTGCCAGCTGGG - Intronic
1081056530 11:38416196-38416218 TTCCCACGTACTTCCCATCCAGG - Intergenic
1081678788 11:44987480-44987502 TTGCCAGGTACTTCCCATCCTGG - Intergenic
1081691453 11:45081148-45081170 TTCCTGGGACCCTCCCATCAAGG + Intergenic
1081715027 11:45244024-45244046 TGCCCAGCTGCCTCCCTTCTTGG - Exonic
1082793851 11:57365975-57365997 TTCCCAGGCCTCTCCCACCAGGG - Intronic
1083289780 11:61683348-61683370 TTCCCTGGTCATTCCCATGTTGG + Intronic
1083299509 11:61732935-61732957 GCCCCAGGGCCCTCCCATCCGGG + Intronic
1084669401 11:70596321-70596343 TGCCCATGCCCCTCCCCTCTTGG - Intronic
1084778957 11:71396388-71396410 GTCCCAGCTCCCTCCCTGCTGGG + Intergenic
1085098398 11:73779544-73779566 TTCCCAGGGCCCGCCCCTCTGGG - Intergenic
1085861403 11:80240270-80240292 TTCCCAGTCCCCTTACATCTAGG + Intergenic
1089030240 11:115319191-115319213 TTCCTACCTCCCTCACATCTAGG + Intronic
1090187080 11:124745858-124745880 TTCCCACCCACCTCCCATCTCGG - Intronic
1090435709 11:126684844-126684866 TTCCCAGGTCCCTCCCGCTGTGG - Intronic
1093988479 12:25564032-25564054 TTTCCAGGTACCACCCATCATGG + Intronic
1094357656 12:29595540-29595562 GTCCCAGGTCCCTCCCTTCCTGG + Intronic
1094691135 12:32770372-32770394 CTTCCAGGTCCTTTCCATCTTGG - Intergenic
1096670741 12:53196935-53196957 TTACCAGGTCCCTGCCCCCTAGG - Intronic
1101319847 12:103663897-103663919 TTCCCCTGTCCCTGTCATCTGGG + Intronic
1101703080 12:107193628-107193650 GTCCCTGCTCCCTCCCATCTGGG - Intergenic
1102625609 12:114233165-114233187 TTCCCTGCTCCCTCCCTGCTAGG + Intergenic
1104416688 12:128601607-128601629 TCCCCAGGGCTCGCCCATCTTGG - Intronic
1104797589 12:131530124-131530146 ATCCCAGGTCTCTCCCAGCATGG - Intergenic
1105045918 12:133003003-133003025 CTCCCAGGTCCCACCCACCTAGG - Intronic
1105775330 13:23654312-23654334 TTCCCATTTCCCTCCCTACTTGG + Intronic
1107594914 13:41953021-41953043 TTCCCAGCTCCCTCCCTGCCAGG - Intronic
1109276716 13:60311771-60311793 GTCCCAGCTCCCTCCCAGCCAGG - Intergenic
1110987389 13:81987765-81987787 TTTCCCCTTCCCTCCCATCTAGG + Intergenic
1111958048 13:94779730-94779752 TTCCCAGGTGATGCCCATCTGGG + Intergenic
1112141772 13:96651642-96651664 TTCCTATGTCCTTCCCACCTTGG + Intronic
1112819885 13:103320224-103320246 TTACCAGGTCTCTTCCACCTTGG + Intergenic
1113625393 13:111792322-111792344 TTCCCAGGTCTCTCTCATAGGGG + Intergenic
1113895509 13:113761486-113761508 TCCCCAGGTGCAGCCCATCTAGG - Intronic
1114443135 14:22766999-22767021 TTCTCAGGGCCCTCCGATGTGGG + Intronic
1118436105 14:65772156-65772178 TTCTAAGGTCCCTTCCAGCTGGG - Intergenic
1118900990 14:69985658-69985680 TGTCCTGCTCCCTCCCATCTGGG + Intronic
1120667170 14:87320246-87320268 GTCCCAGATCTCTGCCATCTTGG + Intergenic
1121100007 14:91243975-91243997 TTCAAAGGTCAGTCCCATCTGGG + Exonic
1121681608 14:95797347-95797369 TTCCCAGGTCCCTTCCAGCTTGG - Intergenic
1122276101 14:100591578-100591600 TTCCCAGATTGCTCCCAGCTAGG + Intergenic
1122800608 14:104227637-104227659 ATCCCAGCTGCCTCCCATCCTGG - Intergenic
1122883021 14:104698595-104698617 TACCCAGGTCCCAGCCATTTGGG + Intronic
1122935775 14:104955419-104955441 CCTCCAGGTCCCTCCCATCCTGG + Intronic
1125833259 15:42730749-42730771 CTCCCAGGTCCCTCCGGTCCTGG - Exonic
1126663389 15:51053796-51053818 TTGCCAAGGCCCTCCCAACTGGG - Intergenic
1128144474 15:65325107-65325129 TTTCCAGACACCTCCCATCTGGG + Intergenic
1128213643 15:65919055-65919077 GGCCCAGGTCTCTCACATCTTGG + Intronic
1128748333 15:70130673-70130695 AGCCCAGGTCCCTGCCAACTAGG + Intergenic
1129540453 15:76343258-76343280 TTCCCAGCTCCCTCCCACCCGGG - Intergenic
1129746266 15:78023630-78023652 GTGTCAGGACCCTCCCATCTTGG + Intronic
1130306320 15:82714277-82714299 TCCCCAGGGCCTTTCCATCTAGG - Intergenic
1131356740 15:91751804-91751826 TCCCCTGTTCCATCCCATCTTGG - Intergenic
1131542446 15:93286584-93286606 AACCCATGTCCCTCCCATCCAGG + Intergenic
1132231318 15:100186481-100186503 TACCCTTTTCCCTCCCATCTTGG + Intronic
1132630521 16:915082-915104 AGCCCAGGACCCTGCCATCTAGG - Intronic
1132857741 16:2054493-2054515 GCCCCAGGTCCTTCCCATCCAGG - Intronic
1133029187 16:3001554-3001576 TTCCCAGGCCGCTGCCCTCTGGG + Intergenic
1134032145 16:11000615-11000637 TTCTCAGAACGCTCCCATCTGGG + Intronic
1136682441 16:31976109-31976131 TTCCCAGAGCCCTCCCTTCTAGG - Intergenic
1136782700 16:32917277-32917299 TTCCCAGAGCCCTCCCTTCTAGG - Intergenic
1136887096 16:33936573-33936595 TTCCCAGAGCCCTCCCTTCTAGG + Intergenic
1138157020 16:54715256-54715278 ACCCCAGCTCCCTCCCCTCTTGG - Intergenic
1138786218 16:59849913-59849935 TTCCCTGCTGCCTCACATCTGGG + Intergenic
1142238923 16:88936243-88936265 CTCCCAGGTATCTCCCATCCTGG + Intronic
1203085354 16_KI270728v1_random:1181261-1181283 TTCCCAGAGCCCTCCCTTCTAGG - Intergenic
1143966949 17:10762283-10762305 TTCCCCGTTCCCTCCCTGCTGGG - Intergenic
1144288061 17:13798798-13798820 TTCCCAGGCTCCTTGCATCTAGG + Intergenic
1144479042 17:15613786-15613808 TTCCCAGACACCTCCCCTCTTGG - Intronic
1144678490 17:17176943-17176965 TGCCCAGGCCCCTCCCTTGTGGG - Intronic
1144919262 17:18749947-18749969 TTCCCAGACACCTCCCCTCTTGG + Intronic
1144997907 17:19283458-19283480 TGCCCTGGTCCTTGCCATCTCGG - Exonic
1145891886 17:28422808-28422830 TTCCCAGATGCCTCCTATTTCGG - Intergenic
1147142962 17:38469447-38469469 TTCCCAGAGCCCTCCCTTCTGGG - Intronic
1147884634 17:43676396-43676418 CCCCCAGCTCCCTCCCATCCCGG + Intergenic
1148127197 17:45242957-45242979 TTCCCCTGTGCCTCCCATCAGGG + Intronic
1148667033 17:49382636-49382658 TGCCCAGCTCCCTCCCGTCAGGG - Intronic
1150834427 17:68551822-68551844 TTCCCAGGGCCACCCCAACTGGG + Intronic
1152310256 17:79545562-79545584 TTCCCAGGTCGCTTCCTTCCAGG + Intergenic
1152716812 17:81904195-81904217 TTCCCTGGTCCTTCCCAGCAGGG + Intronic
1153063937 18:1023755-1023777 TTCCATGGCCCCTCCTATCTGGG - Intergenic
1154389251 18:13922566-13922588 TTCCCACATCCCTCCCAGATTGG + Intergenic
1155904135 18:31429005-31429027 TCCTCAGGTCCCTCTCATTTAGG - Intergenic
1155957652 18:31967292-31967314 TGCCCTGGTCCTTGCCATCTTGG - Intergenic
1157129937 18:44997277-44997299 TTCCCAGAAACCTGCCATCTCGG + Intronic
1157306522 18:46521393-46521415 GGCCCAGGTCCCTCCCATGAAGG + Intronic
1157636131 18:49156817-49156839 TTTCCAGCTCCCTTGCATCTAGG - Intronic
1160480093 18:79232119-79232141 TTACCAGGTCTGTCCCACCTGGG + Intronic
1162334232 19:10050301-10050323 TTCTCACCTCACTCCCATCTAGG - Intergenic
1162602156 19:11677232-11677254 TTCCCGGCGCCATCCCATCTAGG - Intergenic
1163599650 19:18241181-18241203 ATCTCAGGGGCCTCCCATCTGGG - Intronic
1164244622 19:23419179-23419201 TTCCCGGCACCATCCCATCTAGG + Intergenic
1164507949 19:28874832-28874854 CTCCAAGGCCCCTCCCAGCTAGG + Intergenic
1166591231 19:44001272-44001294 TTCCCAGGTCCGTGCACTCTGGG - Intergenic
1166856137 19:45783401-45783423 TTCCCAGGCCCTGCCCAGCTGGG - Exonic
1167506971 19:49876113-49876135 TGCTCAGGTTCCTCACATCTTGG - Intronic
1167565110 19:50251140-50251162 TTCCCAGGTACTTCTCTTCTGGG - Intronic
925884409 2:8382165-8382187 TGTCCAGGTTCCTCCCAGCTTGG + Intergenic
927703114 2:25280443-25280465 TGCCCTGCTCCCTCCCACCTGGG + Intronic
929033798 2:37672162-37672184 TCCCCAGGTCCCTCTCAGCCCGG + Exonic
929943456 2:46352635-46352657 TGGCCAGGTCACTCCCAGCTTGG - Intronic
930909899 2:56618878-56618900 TTTTCTGGACCCTCCCATCTAGG - Intergenic
931282268 2:60804705-60804727 TTCCCAGGTCCCTAAAAGCTAGG + Intergenic
931774076 2:65524868-65524890 ATCCCAGCTCCCTCACCTCTTGG - Intergenic
932058123 2:68467434-68467456 TTTTCACCTCCCTCCCATCTTGG - Intergenic
932277119 2:70459886-70459908 TACCCAGGTGCCTCCCACCTTGG - Intronic
932935820 2:76099678-76099700 TTACCAGGTCCCTCCCACAATGG + Intergenic
935154398 2:100470503-100470525 TCCCCAGTTCCCTCTCATCTTGG + Exonic
935350701 2:102149770-102149792 TCCCCAGCTCCCTTCCATATTGG - Intronic
937250203 2:120519033-120519055 TCTCCAAGTCCCTTCCATCTTGG + Intergenic
937300440 2:120836102-120836124 ATCCCATGGCCCCCCCATCTGGG + Intronic
940108993 2:150129608-150129630 GGCCCAGATCCCTCTCATCTTGG + Intergenic
944667299 2:201968539-201968561 TCCCCTGGTCCCTCCCAGCTCGG + Intergenic
944840796 2:203621863-203621885 TCCCCAAGTCACTCCCCTCTGGG - Intergenic
946383790 2:219368930-219368952 ACCACAGCTCCCTCCCATCTGGG - Intergenic
946771208 2:223090807-223090829 TGCCCAGCTGCCTCCCAGCTGGG - Intronic
946924066 2:224608997-224609019 TTCCCAGCTGCCTTGCATCTAGG + Intergenic
1168990987 20:2095499-2095521 TTGCCTGCTCCCTCCCACCTAGG + Intergenic
1172172102 20:32943527-32943549 GTCCCAGGGCCCTTCCAACTGGG + Intronic
1172205547 20:33160447-33160469 TTCCCAGGAGCCTCCCATAGTGG - Intergenic
1172214824 20:33227757-33227779 TGCACAGGTCCCTCCCACCTGGG + Exonic
1172260719 20:33562430-33562452 TTGGCAGGACCTTCCCATCTGGG + Exonic
1172601999 20:36190481-36190503 TCCCCAAGTCCCTCCCTTCCTGG + Intronic
1174093829 20:48071410-48071432 CTCCCAGGTCCAACCCATCCTGG - Intergenic
1174964825 20:55200302-55200324 TCACCAGGTCCCTCCCAAATTGG - Intergenic
1175105232 20:56610312-56610334 TGCCCAGGTCCCTCCATGCTGGG - Intergenic
1175756064 20:61530984-61531006 TTCCCTTGGCCCACCCATCTGGG - Intronic
1175789893 20:61734687-61734709 TTCCAAGGCCCCTCCCAGCCTGG + Intronic
1175887720 20:62302234-62302256 CTCCCAGATCCCTCCCCTCCGGG + Intronic
1175887760 20:62302316-62302338 CTCCCAGATCCCTCCCCTCCAGG + Intronic
1177831988 21:26149292-26149314 TGGCCAGCTCCCTCCCAGCTGGG + Intronic
1179097114 21:38325732-38325754 TTCCCTGCACCCTCCCATCTAGG - Intergenic
1180840709 22:18957651-18957673 TTCCCAAGCCCCTCCCCTCATGG - Intergenic
1180907185 22:19422733-19422755 TGCCCAGGTCCCTACCCTCCAGG + Intronic
1180954786 22:19736824-19736846 TCTCAAGCTCCCTCCCATCTCGG + Intergenic
1181060778 22:20281123-20281145 TTCCCAAGCCCCTCCCCTCATGG + Intronic
1181430529 22:22878904-22878926 TTCCCAGGTCCTGCTCAGCTGGG - Intronic
1182199304 22:28553311-28553333 TGCCCAGCGCCATCCCATCTAGG + Intronic
1182298947 22:29327378-29327400 TCCCCAGCTCCCTGCCATCTGGG - Intergenic
1182438350 22:30345869-30345891 TTCCCAGGACCCCTCCATCCTGG - Intronic
1183328736 22:37208172-37208194 TTCACAGGGCCCTGCCAGCTGGG - Intronic
1183428693 22:37752829-37752851 TTCCCAGGGCCCTTCCAGTTCGG - Intronic
1184623632 22:45703910-45703932 GCCTCAGGCCCCTCCCATCTCGG + Intronic
1184649088 22:45911498-45911520 TTCCCAGGTCTCTCCAAGCCTGG + Intergenic
1184821186 22:46910323-46910345 GTCCCAGGTCCCTCCTTTGTAGG + Intronic
949551203 3:5114085-5114107 TTCCCAGCCCCATCACATCTAGG - Intergenic
950634529 3:14305506-14305528 TTCCCCCGTGCCTCCCATCTTGG - Intergenic
950735383 3:15003380-15003402 TTCCCAGCTCCATCCCATTGGGG + Intronic
951688883 3:25374572-25374594 TCCCCAGCTCCCTCCCAGTTAGG - Intronic
954403121 3:50329704-50329726 TGCCCAGGATCCTCCCAACTTGG - Intergenic
954593686 3:51805821-51805843 TTCCAGGGTCCCTCTCATCCTGG - Intergenic
955538976 3:59953986-59954008 TTCACAAATTCCTCCCATCTGGG - Intronic
960009376 3:112816764-112816786 TCACCAGGTCCCTCCCATATGGG - Intronic
960029471 3:113042776-113042798 TTAACAGGTCTCTTCCATCTTGG + Intergenic
961326976 3:126114717-126114739 TACCCAGGTCCCTGCCACCTGGG - Intronic
961866692 3:129958620-129958642 GACGCATGTCCCTCCCATCTGGG - Intergenic
962478468 3:135778248-135778270 TTCCCAGGGCCCTTGGATCTGGG - Intergenic
967035178 3:185643656-185643678 TGCCCAGGTCCCTCAGAGCTAGG + Intergenic
967256125 3:187593898-187593920 TTCCCAGGCCCCTCTCCTCCTGG + Intergenic
967478699 3:189949800-189949822 TTCTAAGGTCCCTTCCAACTTGG + Intergenic
967692152 3:192487888-192487910 TTCCCAGGTCCCACTACTCTAGG - Intronic
969308375 4:6338418-6338440 TCCCCAGGTCCCCTCCACCTTGG - Intronic
969396610 4:6925691-6925713 TTCCCAGGTTCCTCCCACTGAGG - Intronic
970104845 4:12569783-12569805 TTCCCCTGTCCCTCATATCTGGG - Intergenic
970785293 4:19789630-19789652 TTCCCATGTCCCTTCCATCCTGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972353580 4:38259951-38259973 TCCCCAGCTCCCTCCCCTCTAGG - Intergenic
972641707 4:40931367-40931389 CTCCCAGGCTCCTCCCACCTCGG + Intronic
973633647 4:52842383-52842405 ACCCCAGGTCCCTTCCAGCTTGG + Intergenic
973728386 4:53799340-53799362 TTTCCAGCTCCCTAACATCTGGG + Intronic
975728969 4:77319377-77319399 TCCCCAGGTCCCTCCTATTCTGG - Intronic
977256970 4:94751916-94751938 TTCCAGGGATCCTCCCATCTTGG + Intergenic
977339558 4:95741498-95741520 TTCCCTAGTCCCACCCATCTTGG + Intergenic
977900472 4:102416432-102416454 TTCCCAGTTCCCTCATTTCTAGG - Intronic
979531569 4:121774087-121774109 TTCCCTGGCCCCTCCCTGCTAGG + Intergenic
980957518 4:139444389-139444411 TTTCCTGGACCCTCCCAGCTGGG - Intergenic
981355144 4:143781291-143781313 TTCCCAGCTTCTTCACATCTGGG - Intergenic
982929966 4:161392456-161392478 TTCCAAGGATCCTCCCACCTTGG + Intronic
984203363 4:176755377-176755399 TACCCAGCTCCCTTGCATCTTGG + Intronic
984935751 4:184888215-184888237 TTCTCTGTACCCTCCCATCTTGG - Intergenic
985642343 5:1069509-1069531 GTCCGAGGTCCCTCCCATGCGGG - Intronic
985983420 5:3490517-3490539 CACCCTGTTCCCTCCCATCTTGG + Intergenic
986236967 5:5919972-5919994 GTCCCAGGCCCCTCAGATCTGGG - Intergenic
988153547 5:27418841-27418863 TTCCCAGGTGTCTTCCAACTGGG + Intergenic
988395548 5:30693539-30693561 TCCTCAGGTCCCCACCATCTGGG - Intergenic
989301501 5:39899581-39899603 TTCCCAGGTTCTTGCCATTTTGG - Intergenic
989342204 5:40388527-40388549 TTATCTGCTCCCTCCCATCTGGG + Intergenic
989765320 5:45075974-45075996 GTCCCAGATCCCTCACTTCTTGG + Intergenic
991637699 5:68722822-68722844 TTCCCAAGTTCCTCCAATGTAGG - Intergenic
993809991 5:92464207-92464229 TCCCCAGGTCCCTCCTCTCTGGG + Intergenic
994689447 5:102999159-102999181 CTACCAGGTCCCTCCCAAATGGG + Intronic
995722606 5:115151917-115151939 TTCCTAGTTCCTTCCCATTTCGG - Intronic
996810056 5:127506713-127506735 TTTCCAGCTCCCTCACACCTTGG - Intergenic
998969324 5:147574412-147574434 TCCCCATGTGCCTCTCATCTGGG + Intergenic
999126614 5:149250685-149250707 TTCCCAAGCCCCTCCCATGGGGG - Intronic
999525943 5:152405435-152405457 TTCCCAGCTCCTTCCCATTCAGG - Intronic
1001086095 5:168701019-168701041 ATTCCAGCTCCATCCCATCTGGG + Intronic
1001310079 5:170604167-170604189 CTCCCCGGCCCTTCCCATCTTGG - Intronic
1002561706 5:180086989-180087011 TTCACAGGCCCCTCCCCGCTGGG + Intergenic
1002912158 6:1498600-1498622 TTCCCAGGCATCTGCCATCTGGG + Intergenic
1003258460 6:4494450-4494472 TCCCCAGGCCCCTTGCATCTAGG - Intergenic
1005686915 6:28262033-28262055 TGCCCAGACCCCTCCCACCTAGG - Intergenic
1006475152 6:34248514-34248536 CGCCCAGGTCCCTCCCCTCCTGG + Intronic
1007599382 6:43072282-43072304 TCCCCAGGGCCCTTCCCTCTAGG - Intronic
1009961723 6:70530892-70530914 TTCCCAGGACCCTCAGTTCTTGG - Intronic
1013219720 6:108067458-108067480 TGTCCAGCTCTCTCCCATCTTGG + Intronic
1014187455 6:118452267-118452289 TTACCAGGTCCATTCCACCTTGG - Intergenic
1016997637 6:149971278-149971300 TTCCCAGGCCCTCCCCATTTCGG - Intronic
1019928133 7:4206487-4206509 TTCCCAGGGACCTCACATCTGGG - Intronic
1022104843 7:27190182-27190204 CTCCCAGGCCTATCCCATCTGGG - Intergenic
1022490889 7:30816679-30816701 TACCCAAGTCTCTCTCATCTGGG - Intronic
1023161786 7:37303997-37304019 TTCCGAGCTCCCTCTCATTTAGG + Intronic
1023522061 7:41058928-41058950 TCCCCAGGGCCCTGCCATATTGG - Intergenic
1024297886 7:47860899-47860921 TTCCCAGGTCCCTCGAGTCCAGG + Intronic
1024491071 7:49986391-49986413 TTCCCCCTTCCCTCCCAGCTGGG + Intronic
1026775281 7:73227304-73227326 TTCCCGGGTCCCTCTTCTCTTGG + Intergenic
1026959978 7:74401586-74401608 CTCCCAGGTCCCTCCCGTGCAGG + Intronic
1027016138 7:74780675-74780697 TTCCCGGGTCCCTCTTCTCTTGG + Intronic
1027071890 7:75165262-75165284 TTCCCGGGTCCCTCTTCTCTTGG - Intergenic
1029440200 7:100583130-100583152 TTCCCAGGTCCCTCCCATCTGGG + Intronic
1031997990 7:128245497-128245519 TCCCCAAGTCCCTTCCAACTTGG + Intronic
1033468443 7:141620511-141620533 TTCCCCTGTCTCTCCAATCTTGG - Intronic
1035118573 7:156545801-156545823 TTCCCAGGTTTCTCACATCCAGG - Intergenic
1035318427 7:158012833-158012855 TTGCCAGCTCCCTTTCATCTAGG - Intronic
1035682838 8:1500991-1501013 TTCCCCGGTTCCTTCCAGCTGGG - Intergenic
1037689144 8:21168243-21168265 TCTCCAGGTCTCTCCCATCGGGG + Intergenic
1039951421 8:42175818-42175840 TTCCCAGATACTTCCCATTTTGG - Exonic
1042745526 8:72102302-72102324 TTTGCAGGTCCCTTCCCTCTTGG + Intronic
1043305661 8:78791194-78791216 GTCCCTGATCCCTCCCACCTTGG + Intronic
1045397092 8:101772012-101772034 TTCCCAGGTCCCTACCACTCAGG - Intronic
1047097667 8:121641528-121641550 CTCCCAGTTCCCTCCCCTCAGGG - Intergenic
1047625003 8:126647453-126647475 ATCCCATGCCACTCCCATCTTGG - Intergenic
1047723239 8:127661882-127661904 TGCCCAGCTCCCTGCCTTCTAGG + Intergenic
1048266502 8:132991972-132991994 TTCCCAGTTCCCTTCCTTCCTGG + Intronic
1048302226 8:133260210-133260232 TTCCAAGGTCCCTCCTGTGTAGG + Intronic
1048323321 8:133418775-133418797 TTCCCAGGGCCTTGGCATCTGGG + Intergenic
1049183141 8:141233756-141233778 TTCCCAGGGGCCTGCCGTCTTGG - Intronic
1049694601 8:143977158-143977180 TTCCCGGGTCCCTTCCGCCTGGG + Exonic
1050795485 9:9535516-9535538 TTCAAAGCTCCCTCCCCTCTGGG - Intronic
1051501397 9:17781773-17781795 TTCCCAGGTCTCTCCCTTTACGG + Intronic
1053067638 9:35079598-35079620 TGCCCAGGCCCCTCCCCGCTGGG - Exonic
1056488413 9:87082166-87082188 TCCCCAGGTTCCTCGCATCTAGG + Intergenic
1057798784 9:98176629-98176651 TTCCCATGTCCTCCCCATTTTGG + Intronic
1058880013 9:109277818-109277840 TTCCCAGTTCCCCTCCCTCTGGG - Intronic
1060264347 9:122101836-122101858 GCCCCAGTTCCCTCCTATCTCGG - Intergenic
1061096293 9:128458507-128458529 TTCCAAGGCCCTTCCCATCCTGG + Intronic
1061243011 9:129385172-129385194 TTCCCAGGACACTCCCTTTTGGG - Intergenic
1062382455 9:136293026-136293048 TTGCCAGGGCCCTCGCAGCTGGG - Intronic
1062632166 9:137468087-137468109 TTCCCAGGCTCCTCCCTTCCAGG - Intronic
1186757879 X:12691836-12691858 GTCCCAGCTCCCTCGCCTCTCGG - Intronic
1187948686 X:24451173-24451195 ATCCCAGGTCCCTTGCCTCTCGG + Intergenic
1189316363 X:40059522-40059544 ATCCCATCACCCTCCCATCTAGG - Intronic
1189856424 X:45229265-45229287 ATGCCAGGTCCCTGCCACCTTGG - Intergenic
1191630356 X:63315200-63315222 TTCTCCGGACCCTCCCAACTGGG + Intergenic
1194448535 X:94015040-94015062 TTTTCAGGTCCCTTCCCTCTTGG + Intergenic
1194890676 X:99374290-99374312 TTCCCAGGTGCTCACCATCTTGG + Intergenic
1195692269 X:107636693-107636715 CTCCCAGCTCCCTTTCATCTTGG + Intronic
1196417989 X:115493384-115493406 TGCCCAGTTCCTTACCATCTTGG + Intergenic
1197324457 X:125074819-125074841 TTCCCACTTCCCTATCATCTAGG + Intergenic
1198636056 X:138701697-138701719 TTCCCACCTCTTTCCCATCTTGG + Intronic
1199974836 X:152887757-152887779 TTGCCAGTACCCTCGCATCTAGG - Intergenic
1200123341 X:153801628-153801650 TTGCCAGGGCCCTTCCATCCTGG - Intergenic
1201261087 Y:12159570-12159592 GTCACAGGTCCCACCAATCTGGG + Intergenic